Labshake search
Citations for Merck :
201 - 250 of 807 citations for 7 Bromo 3 methyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Neuroscience 2022Quote: 6-7 dpf zebrafish larvæ were deeply anesthetized using 0.2% Ethyl3-aminobenzoate methanesulfonate (MS222; Merck KGaA, Darmstadt, Germany) diluted in EM ...
-
bioRxiv - Immunology 2024Quote: ... ∼5,000 previously anti-dinitrophenyl (DNP) IgE-sensitized lung MCs (overnight at 1 µg/ml, clone SPE-7, Merck) were washed in Tyrode buffer (Merck ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Microbiology 2023Quote: ... containing solid (7 g L−1 agar) full-strength Hoagland (2.75 mL well−1; pH adjusted to 6.5) (Sigma-Aldrich, Merck), sealed with parafilm and placed under the growth chamber ...
-
bioRxiv - Neuroscience 2023Quote: ... the two solutions were mixed in a 1:1 ratio and 7 drops of accelerator DMP-30 (45348, Merck) per 10 mL of Epon-mixture was added ...
-
bioRxiv - Neuroscience 2021Quote: ... and Pellet Paint Co-precipitant (Merck Millipore #69049-3). Genomic DNA traces were removed with DNA-free DNase Treatment and Removal Reagents (FisherScientific #AM1906 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Bioengineering 2019Quote: ... molecular weight cut-off 3 kDa (Amicon®, Merck) to a concentration of 1 mg/mL as determined by Qubit Protein Assay Kit (Invitrogen™ ...
-
bioRxiv - Biochemistry 2020Quote: ... using 3 kDa MWCO Amicon centrifugal filters (Merck Millipore). For protein denaturation ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... the anti-S tag antibody (Merck, Cat# 71549-3) was added directly to the medium of each well resulting in a final dilution of 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated with Benzonase Nuclease (Merck Millipore, US170664-3) for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 3-HA were purchased from Merck (Sigma-Aldrich). For L-kynurenine and kynurenic acid ...
-
bioRxiv - Genomics 2022Quote: ... and subsequently blocked in 3% BSA (A8022, Sigma/Merck) in 1x PBS-Tween (137 mM NaCl ...
-
bioRxiv - Plant Biology 2023Quote: ... using a 3 kDa MWCO Amicon centrifugal concentrator (Merck) and the N-terminal His6-tag cleaved with Human Rhinovirus 3C protease at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Immunology 2021Quote: ... Cloning of the antigen library into the T7 phages was performed following manufacturer’s instructions (T7Select 10-3 cloning kit, catalog no. 70550-3, Merck-Millipore, Burlington, MA, USA).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Neuroscience 2020Quote: ... two custom-made Teflon containers of 5 mm diameter were filled with 10 μl of odor substance (n-amylacetate, AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Cell Biology 2022Quote: ... the iMEF cells were incubated for 7 days with HOT or vehicle and with 100 ng/ml nocodazole (Merck, M1404) in DMSO or with vehicle for 18 h before sample collection ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Immunology 2023Quote: ... WT mice were 7-8 week-old Mice (C57BL/6 WT or Nr4a3-Timer-GS) were injected with 10 mg/kg azoxymethane (Merck) via i.p ...
-
bioRxiv - Bioengineering 2023Quote: Microvessels cultured under different flow conditions were perfused at day 7 or 14 with 70 kDa FITC-labelled dextran (Merck) by the application of a hydrostatic pressure drop across the central gel channel ...
-
bioRxiv - Biochemistry 2023Quote: ... the Siglec-7-Spy Tag-TEV-Fc was concentrated using an AMICON (Molecular Weight Cut Off 30 kDa – Merck Millipore) to approximately 0.15 mg/ml measured via NanoDrop as described above ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... CDK9 was immunoprecipitated with 15μg of an anti-CDK9 antibody (D-7, sc-13130, lot no # B1422) or control mouse IgG (12-371, Merck) in IP Buffer with 2X SDS buffer (100mM NaCl ...
-
bioRxiv - Pathology 2023Quote: Cryosections of formalin-fixed lung tissue 7 μm thick were washed in PBS and permeabilized for 1 h with 0.01% Tween 20 (Sigma-Merck, Germany), followed by three washes in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... peptides (<3 kDa) were separated from high molecular size proteins by a 3 kDa cutoff ultrafiltration column (Amicon®, Merck Millipore Ltd., Cork, Ireland). The crude peptides (<3 kDa ...
-
bioRxiv - Neuroscience 2019Quote: ... After washing (5x 3 min) with deionized water (“MilliQ”, Merck Millipore ...
-
bioRxiv - Biochemistry 2021Quote: ... Centrifugal filters (0.5 mL, 3 k) were purchased from Merck KGaA (Darmstadt ...
-
bioRxiv - Plant Biology 2021Quote: ... brassicicola was maintained on malt medium (3% malt extract (Merck), 1.5% agar-agar (Roth) ...