Labshake search
Citations for Merck :
201 - 250 of 4461 citations for 6 Amino 3 morpholin 4 ylmethyl indazole 1 carboxylic acid tert butyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... All samples were fixed 1:1 with 4% PFA (Merck, no. P6148) (final concentration 2% PFA ...
-
bioRxiv - Cancer Biology 2024Quote: ... colonies from MDA-MB-468 cells were fixed by replacing the medium with a solution of 3% trichloroacetic acid in water (Merck, #T6399-500G), rinsed twice with water ...
-
bioRxiv - Neuroscience 2023Quote: Trypsinise Ara-C purified SCs using 1 ml of 6% 2 mg ml-1 Trypsin (Merck - 85450C) in Versene (0.02% EDTA (Thermo Fisher - D/0700/53 ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... IL-10 and TNF-α were quantified in the FN of NL and at 21dpi aged GFAP-IL6Tg and WT mice (n= 4-6/experimental group) using a Milliplex MAP Mouse High Sensitivity kit (#MHSTCMAG-70K; Merck Millipore), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Brilliant Crocein/Acid Fuchsin (Brilliant Crocein R, Chroma, and Acid Fuchsin, Merck), 5% Phosphotungstic acid PTA (Chroma) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Formic acid Ammonium formate and Perchloric acid were also purchased from Merck. Sodium dihydrogen phosphate and di-Sodium hydrogen phosphate were used to prepare the buffer for the enzymatic assay.
-
bioRxiv - Microbiology 2022Quote: ... citric acid (Merck, USA), lactic acid ...
-
bioRxiv - Neuroscience 2019Quote: ... 5% acetic acid (Merck), and dried using SpeedVac (Eppendorf) ...
-
bioRxiv - Biochemistry 2021Quote: ... Hydrochloric acid(Merck, India), Sodium dodecyl sulphate(Merck ...
-
bioRxiv - Biochemistry 2021Quote: ... Acetic acid(Merck, India), Methanol(Merck,India),-20°C Refrigerator ...
-
bioRxiv - Genomics 2021Quote: ... propionic acid (Merck, 8.00605.0500) (3 mL/L ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5M acetic acid (Merck) was added to reach 500 μL ...
-
bioRxiv - Bioengineering 2023Quote: ... tannic acid (403040, Merck); Iron chloride tetrahydrate (380024 ...
-
bioRxiv - Bioengineering 2023Quote: ... citric acid (Calbiochem, Merck), acetic acid (EMSURE ...
-
bioRxiv - Bioengineering 2023Quote: ... acetic acid (EMSURE, Merck), penicillin-streptomycin (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... periodic acid (Merck, 100524) was applied for 10 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... and naphthylphthalamic acid (Merck) were supplemented at concentrations indicated in the corresponding figures from 103 concentrated stocks dissolved in dimethylsulfoxide (Acros) ...
-
bioRxiv - Neuroscience 2024Quote: ... oleic acid (W281506, Merck), linoleic acid (436305 ...
-
bioRxiv - Neuroscience 2024Quote: ... linoleic acid (436305, Merck) and α-linolenic acid (L2376 ...
-
bioRxiv - Immunology 2019Quote: ... HLA molecules and peptides were eluted with 1% trifluoroacetic acid (TFA, Merck, Darmstadt, Switzerland) directly into Sep-Pak tC18 100 mg Sorbent 96-well plates (Waters ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Tryptic peptides were acidified to a final concentration of 1% formic acid (FA) (Merck), cleaned up using SepPak cartridges (Waters) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilizing the beads on the magnetic rack ...
-
bioRxiv - Developmental Biology 2023Quote: ... We used Hoyer’s mounting medium in a1:1 proportion with lactic acid (90% MERCK) to preserve the cuticle of the legs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilizing the beads on the magnetic rack ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilising the beads on the magnetic rack ...
-
bioRxiv - Biochemistry 2024Quote: ... HPLC-grade trichloroacetic acid (TCA) and difluoroacetic acid (DFA) were purchased from Merck and Sigma-Aldrich (Munich ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Molecular Biology 2019Quote: Inflorescences were harvested into fresh fixative (3:1 96% ethanol (Merck) and glacial acetic acid ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Immunology 2020Quote: Survival was determined by assessing the fraction of vital cells at defined time points during culture by flow cytometric exclusion of 4’,6-Diamidin-2-phenylindol (DAPI) (Merck, Darmstadt, Germany) and Annexin V-APC (BD Biosciences ...
-
bioRxiv - Molecular Biology 2023Quote: ... a total of 0.4–0.5 μg of plasmid and dsRNAs were transfected into BmN4 cells (4–6 × 104 cells per glass bottom 35 mm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche) and cells were fixed 5–6 days later ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6), anti-GFAP (goat polyclonal ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.3 U hexokinase (Scientific Laboratory Supplies) and 1 U glucose-6-phosphase dehydrogenase (Merck) in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6) or 1:200 anti-oxytocin receptor (polyclonal rabbit ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 M urea (Merck), 1% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 % Triton-X and 1x BugBuster (Merck Millipore, #70584-4) were added to lyse the bacteria for 30 min at 4 °C with gentle rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM TCEP with 4% SYPRO Orange dye (Merck, #S5692) were filtered in SpinX tubes (Corning ...
-
bioRxiv - Biochemistry 2023Quote: ... 40 μg of protein was added to each well and run in Boric acid-Tris buffer (192 mM Boric acid, Merck; 1 mM EDTA, Merck; 0.1% SDS, to pH 7.6 with Tris) at 25 mA for 1.5 h ...
-
bioRxiv - Microbiology 2020Quote: ... and finally through a 0.22 μm collection filter (Cellulose mixed ester membrane filter; Merck Millipore, USA). The pre-processed samples were then kept in 2 ml microcentrifuge tubes ...
-
bioRxiv - Microbiology 2022Quote: ... followed by filtration through a MF-Millipore 8 µm sterile mixed cellulose ester (MCE) membrane (Merck Millipore Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: ... and counterstained with Fast Green (0.04% w/v in 1% acetic acid, Merck, Darmstadt, Germany).
-
bioRxiv - Molecular Biology 2023Quote: ... To deplete Xrn1 and Dcp2 with the AID tags (Nishimura et al., 2009; Morawska and Ulrich, 2013) 1-Naphthaleneacetic acid (1-NAA; N0640-25G, Merck) was added to a final concentration of 1 mM ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...