Labshake search
Citations for Merck :
201 - 250 of 5376 citations for 5 1 3 Dioxolan 2 yl 2 3 fluorobenzoyl thiophene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 3 units/ ml nystatin (Merck: N1638) and 20 mM HEPES ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3% bovine serum albumin (Merck). The azide-alkyne reaction was performed using the Click-iT™ Cell Reaction Buffer Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... nystatin (3 units/ml) (Merck: N1638) and ascorbic acid (500 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (Merck; UK 28718-90-3) was included as a final wash stage ...
-
bioRxiv - Developmental Biology 2024Quote: ... or 3% Rabbit Serum (R9133, Merck)) and finally applying the conjugated antibody ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Cell Biology 2023Quote: ... the reducing agent 2 µl 2-picoline borane complex (PB, 2 M in DMSO, Merck) and 2 µl water ...
-
bioRxiv - Genomics 2023Quote: ... then immersed in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed three times with DPBS for 5 minutes and incubated for 1 hour with respective secondary antibodies (Suppl. table 3) and DAPI (#10236276001; Merck Life Science, Dorset, UK) for nuclear counterstaining in 1% donkey serum ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were mounted using a 3:1 solution of Canada balsam (Merck, # 1016910100) and Histoclear (HS-202 HISTO-CLEAR II ...
-
bioRxiv - Cell Biology 2020Quote: ... or rabbit anti-p34-Arc/ARPC2 (Arp2/3, 1:100, Merck, 07-227). This was followed by incubation with appropriate Alexa Fluor-conjugated secondary antibodies (1:500 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM DTT) and concentrated using a 3 kD MWCO centricon (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
Highly amine-reactive graphene-oxide EM grids for biochemical surface modification in aqueous bufferbioRxiv - Molecular Biology 2023Quote: ... 4-Amino-1-butanol (#178330) and 3- glycidoxypropyltrimethoxysilane (#440167) were obtained from Merck. Gold nanoparticle- PEG-amine conjugate was custom-synthesized by NanoPartz (Loveland CO ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
bioRxiv - Biophysics 2023Quote: ... 2-aminoethoxydiphenyl borate (2-APB) (Sigma-Aldrich/Merck, Germany), BL-1249 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (all Merck). The pH was adjusted to 7.3-7.4 (S20 ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 50 µL chloroform : methanol (2 : 1) and 5 µL were loaded on silica gel 60 F254 plates (Merck). To separate trehalose esters of mycolates (TDM ...
-
bioRxiv - Biochemistry 2023Quote: ... membranes were blocked with 5% BSA in TSMT (20 mM Tris; 150 mM NaCl, Merck; 1 mM CaCl2, Sigma; 2 mM MgCl2, Merck; adjusted to pH 7 with HCl ...
-
bioRxiv - Pathology 2023Quote: ... 1 µl of CAA (400mM 2-Chloroacetamide (#C0267, Merck) was added ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Genetics 2024Quote: ... The LC separation was performed using the SeQuant Zic-pHilic (150 mm 3 2.1 mm) with the SeQuant guard column (20 mm 3 2.1 mm) (Merck). Mobile Phase B was acetonitrile ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mg/ml collagenase P (Merck), 1 mg/ml collagenase B (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3% Normal donkey serum (NDS, Merck), 2%BSA (NACALAI TESQUE) ...
-
bioRxiv - Microbiology 2024Quote: ... and 3% Normal Goat Serum (Merck, S26)) for 1h at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.625 mM TBTA (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine) (Merck Millipore), and 6.25 mM CuSO4 (Merck Millipore) ...
-
bioRxiv - Immunology 2024Quote: ... we included αTIM-3+ αPD-1 and used anti-human RSV-IgG4 as an isotype control antibody (5 μg/mL, 60AGK S228P, Merck & Co., Inc., Rahway, NJ, USA). On day six ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 2 % (vol/ vol) FCS and and 10 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, Merck) and cut into 1 cm pieces ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SCD-MSG medium consisted of 0.17% yeast nitrogen base without amino acids and ammonium sulfate (Formedium ...