Labshake search
Citations for Merck :
201 - 250 of 1716 citations for 4 Hydroxy 7 trifluoromethyl quinoline 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Microbiology 2024Quote: ... and 3% Normal Goat Serum (Merck, S26)) for 1h at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mg/ml collagenase P (Merck), 1 mg/ml collagenase B (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3% Normal donkey serum (NDS, Merck), 2%BSA (NACALAI TESQUE) ...
-
bioRxiv - Neuroscience 2024Quote: ... and pyridine (Merck, Germany, 9:3:1) in a GC vial for GC–mass selective detector non-cholesterol and oxysterol analysis ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 µM IWR-1 (I0161, Merck) with 20 µM Y27632 ...
-
bioRxiv - Immunology 2022Quote: Murine lungs were perfused and fixed overnight at 4 °C in 4% paraformaldehyde (Merck Millipore) under agitation ...
-
bioRxiv - Developmental Biology 2023Quote: ... slides were incubated for 4 h at 4°C with DAPI (1 µg/mL, Merck) and the following secondary antibodies diluted in blocking buffer ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Biochemistry 2024Quote: ... and 3 μL (equivalent to 3 mg cell dry weight) were spotted on HPTLC silica gel 60 plates (Merck) and developed in chloroform/methanol/13 M NH3/1 M NH4Ac/water (180:140:9:9:23 ...
-
bioRxiv - Plant Biology 2021Quote: ... Individual sporophytes were subsequently transferred to GA-7 Magenta boxes (Merck Life Science UK Ltd., Dorset, UK) containing 100ml C-fern agar media when two fronds were visible (10-14 days old) ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Genomics 2023Quote: ... All sections from each sample were homogenised using a 7 ml glass Dounce tissue grinder set (Merck) with 8–10 strokes of a loose pestle (A ...
-
bioRxiv - Developmental Biology 2024Quote: ... All sections from each sample were homogenised using a 7 ml glass Dounce tissue grinder set (Merck) with 8–10 strokes of a tight pestle (B ...
-
bioRxiv - Developmental Biology 2024Quote: ... All sections from each sample were homogenised using a 7 ml glass Dounce tissue grinder set (Merck) with 8–10 strokes of a tight pestle (B ...
-
bioRxiv - Genomics 2020Quote: ... Teratomas that developed within 4 weeks post-injection were harvested and fixed in 4% paraformaldehyde (Merck), embedded in paraffin ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed using 4% paraformaldehyde (Merck, 1040051000) in PBS and permeabilized by CSK buffer (25 mM HEPES pH 7.8 ...
-
bioRxiv - Genetics 2021Quote: ... fixed with 4% paraformaldehyde (PFA, Merck) in PBS (pH = 7.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... and fixed in 4% paraformaldehyde (Merck) overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg/ml heparin (Sigma/Merck), 20 ng/ml EGF (Peprotech) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 4 g/l thiamine-HCl (Merck), and 40 g/l myo-inositol (Merck) ...
-
bioRxiv - Genomics 2020Quote: ... and Tubulin beta 4 (#T7941, Merck). To do so ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 mM glutamine (Merck KGA, Germany), 1 mM sodium pyruvate (Merck KGA ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 μg/mL PI (Merck, Germany) and 12 μg/mL Hoechst 33342 (Miltenyi Biotec ...
-
bioRxiv - Microbiology 2024Quote: ... were fixed with 4% formaldehyde (Merck) diluted in PBS 1X for 10 min at room temperature and then washed 3 times with PBS 1X ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 4 % PFA (1004005, Merck) (w/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-Hydroxytamoxifen (4OHT) (Merck Sigma-Aldrich) was added at a final concentration 100 nM for 10-12 hours to induce the recombination of the Lynflallele.
-
bioRxiv - Bioengineering 2023Quote: ... MOWIOL 4-88 Reagent (475904, Merck); LysoTracker Deep Red (L12492 ...
-
bioRxiv - Bioengineering 2024Quote: ... MOWIOL 4-88 reagent (475904, Merck); High Pure RNA Isolation Kit (11828665001 ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The embryos were then incubated with anti-cleaved caspase 3 pAb (1:100) (Anti-caspase-3, cleaved (Ab-2) Rabbit pAB (PC679; Merck) followed by a wash and a second incubation with anti-rabbit 568 ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...