Labshake search
Citations for Merck :
201 - 250 of 3015 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Genetics 2024Quote: ... The harvested medium was then centrifuged at 1,300 rpm at 4 °C for 5 min to remove cells and then filtered by 0.45 μm filter (Merck) and the virus was collected and stored at -80 °C.
-
bioRxiv - Biochemistry 2024Quote: ... Ultrapure nitric acid was produced in-house from trace analysis grade nitric acid (Merck, Darmstadt, Germany) using a SubPur quartz sub-boiling distillation system (Milestone ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 100mM ascorbic acid (Merck Millipore). After four washes with TBS containing 0.5% Triton X-100 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... acid fuchsin (C.I.42685, Merck-Millipore), and azofloxine (C.I.18050 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cyclopianozic acid (CPA, Merck-Sigma-Aldrich), a blocker of the sarco/endoplasmic reticulum Ca2+-ATPase pump (SERCA ...
-
bioRxiv - Biochemistry 2020Quote: ... all-trans-retinoic acid from Merck Millipore ...
-
bioRxiv - Cancer Biology 2020Quote: ... in 2 mM acetic acid (Merck), anti-mouse-CD3 (BD) ...
-
bioRxiv - Cell Biology 2021Quote: ... Acetic acid was purchased from Merck, US ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.1% (v/v) formic acid (Merck), incubated 15 min in an ultrasonic bath (VWR ...
-
bioRxiv - Pathology 2022Quote: ... acid fuchsin (C.I.42685, Merck-Millipore), and azofloxine (C.I.18050 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... amino-acid standards (Merck, Darmstadt, Germany) were analyzed under the same conditions in order to determine typical retention times.
-
bioRxiv - Synthetic Biology 2021Quote: ... Amino-acid standards (Merck, Darmstadt, Germany) were used to determine specific retention times.
-
bioRxiv - Microbiology 2020Quote: ... n-valeric acid (Merck, Darmstadt, Germany) and n-caproic acid (Carl Roth ...
-
bioRxiv - Cell Biology 2021Quote: ... Acetic acid was purchased from Merck, US ...
-
bioRxiv - Neuroscience 2020Quote: ... Triflic anhydride (trifluoromethanesulfonic acid anhydride, Merck/Sigma and sodium azide in analogy to the synthesis of AHA from Boc-Dab described by(Link et al. ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Ascorbic acid was obtained from Merck Ltd. ...
-
bioRxiv - Neuroscience 2023Quote: ... Flufenamic acid (FFA, Merck-Sigma-Aldrich) was first diluted in 100 mM DMSO and then in Low Ca+Co saline at a concentration of 100 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... Cyclopianozic acid (CPA, Merck-Sigma-Aldrich) was diluted to 20 mM in DMSO and used at a final concentration of 20 μM in Low Ca+Co.
-
bioRxiv - Physiology 2023Quote: ... 200 μM L-ascorbic acid (Merck), and CaCl2 (to the final concentration of 1.8 mM) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2mM Ethylenediaminetetraacetic acid (EDTA, Merck).
-
bioRxiv - Developmental Biology 2023Quote: ... Retinoic Acid (RA; 0.5 µM, Merck) was added from day 90 to day 120 of differentiation ...
-
bioRxiv - Neuroscience 2024Quote: ... and α-linolenic acid (L2376, Merck).
-
bioRxiv - Cancer Biology 2024Quote: ... 10 µM oleic acid (Merck, #O1008), or vehicles (0.05% DMSO and 0.02% ethanol) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 80 µM ascorbic acid (Merck). Fresh ascorbic acid solution in water was prepared every time and added to the click mix immediately before the start of click reaction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Amino acid standards (Merck, Darmstadt, Germany) were analyzed beforehand to determine typical retention times.
-
bioRxiv - Biochemistry 2022Quote: ... LC-MS grade formic acid (Merck), LC-MS grade water (Merck) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX™ (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX ™ (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... and 80 µM ascorbic acid (Merck). Fresh stock of ascorbic acid solution in water was prepared every time and added to the click mix immediately before starting the click reaction ...
-
bioRxiv - Plant Biology 2024Quote: ... Lipoic Acid (LA, 1/1000, Merck), RPS6 (1/1000 ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 µM retinoic acid (R2625, Merck) was added ...
-
bioRxiv - Microbiology 2024Quote: ... 50 µg/ml Mycophenolic acid (Merck) and Xanthine (Sigma ...
-
bioRxiv - Pathology 2024Quote: ... Hydrochloric acid was purchased from Merck KGaA (Darmstadt ...
-
bioRxiv - Neuroscience 2024Quote: ... Acetic Acid 10% (Merck, cat. 695092) over-night ...
-
bioRxiv - Cell Biology 2024Quote: ... Oleic and palmitic acid (both Merck) were coupled to the HCM bulletkit derived BSA by incubation at 37°C for at least 2 h ...
-
bioRxiv - Biochemistry 2024Quote: ... Bile acids were supplied by Merck KGaA (Darmstadt ...
-
bioRxiv - Cell Biology 2024Quote: ... 1x Non-Essential Amino Acids (Merck KGaA ...
-
bioRxiv - Bioengineering 2024Quote: ... 50 μg/mL ascorbic acid (Merck), 4.7 μg/mL linoleic acid-oleic acid (Merck) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 500 μM Valproic acid (Merck PHR1061), 5 μM Tranylcypromine (Cayman Chemicals 10010494) ...