Labshake search
Citations for Merck :
201 - 250 of 3819 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... The nuclei were stained with 4′,6-diamidin-2-phenylindol (DAPI, Merck, Germany).
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Neuroscience 2024Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (D9542) (all from Merck, Auckland, NZ). See table S2 for antibodies used for immunocytochemistry (ICC).
-
bioRxiv - Microbiology 2024Quote: ... was obtained by using 4’,6-di-amidino-2-phenyl-indole (DAPI; Merck KGaA - Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Microbiology 2020Quote: ... Peptides were dissolved in 2% acetonitrile containing 0.1% trifluoroacetic acid and desalted using C18 ZipTips (Merck Millipore, Germany). Each sample was independently analysed on a Q-Exactive hybrid quadrupole-orbitrap mass spectrometer (Thermo Scientific ...
-
bioRxiv - Genomics 2021Quote: ... and gentisic acid (2,5-dihydroxybenzoic acid; Merck, Product Number: 841745) was performed in AT minimal medium (86 ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested peptides were acidified by the addition of 5% (v/v) LC-MS grade Formid Acid (FA) (Merck, 5.33002.0050) and purified on C18 columns (Stagetips ...
-
bioRxiv - Biochemistry 2021Quote: ... Reactions were stopped at each time point using 4 N formic acid and analyzed by PEI-Cellulose-F TLC (Merck) developed in 0.4 M potassium phosphate buffer (pH 3.4) ...
-
bioRxiv - Neuroscience 2023Quote: ... before transcardially perfusing with 21-28 ml of ice-cold PBS and 4%PFA-0,12% picric acid (Merck, Søborg, Denmark). Spleens were excised and weighed ...
-
bioRxiv - Microbiology 2020Quote: ... Formic acid (Merck) was added to end the reaction (5% v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Trichloroacetic acid(Merck), Fetal Bovine Serum (Merck ...
-
bioRxiv - Immunology 2023Quote: ... with Ehrlich’s reagent (Sigma)/perchloric acid (Merck) and absorbance was measured at 557 nm ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (#D9542, Merck. Darmstadt. Germany).
-
bioRxiv - Physiology 2022Quote: ... cultures were fixed with 4% PFA and stained with 2% Alizarin red S (Merck). For the quantification ...
-
bioRxiv - Developmental Biology 2024Quote: ... grids were post-stained with 2% aqueous uranyl acetate at pH 4 (Merck, Germany) and Reynold’s lead citrate ...
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1 mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 4 h with 5 mg/ml Brefeldin A (Merck, Darmstadt, Germany) after 140 h incubation time ...
-
bioRxiv - Cancer Biology 2024Quote: ... colonies from MDA-MB-468 cells were fixed by replacing the medium with a solution of 3% trichloroacetic acid in water (Merck, #T6399-500G), rinsed twice with water ...
-
bioRxiv - Biophysics 2024Quote: Glass coverslips (Paul Marienfeld GmbH, 24 x 50 mm, 170 ± 5 μm) were overnight incubated in 100 mM Sulphuric acid (Merck). Afterwards the coverslips were rinsed consecutively with Milli-Q water ...
-
bioRxiv - Molecular Biology 2020Quote: ... EmbryoMax KSOM medium with 1/2 amino acids without BSA (Reagent setup; Merck Millipore, cat. no. MR-107-D), BSA powder (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... resolubilized in 25 µL of 0.05% trifluoroacetic acid in 98:2 H2O/acetonitrile (v/v) and filtrated through a 0.2 µm spin filter (Merck Millipore Ultrafree®-MC ...
-
bioRxiv - Microbiology 2024Quote: ... Samples for VFA determination were further fixed by adding 1% v/v of 4 M sulfuric acid (H2SO4, Merck Millipore, Germany). The concentrations of VFAs and sulfate were determined using a 930 Compact IC Flex 1 with a Metrosep A supp 7 −250/4.0 column coupled with an 887 Professional UV/VIS detector (Metrohm ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Biophysics 2024Quote: ... The 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck (Darmstadt, Germany). Cholesterol (Chol ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal anti-α-tubulin clone B-5-1-2 (Merck T5168; 1:5000), mouse monoclonal anti-EF-18 clone A-5 (Santa Cruz Biotechnology sc-393731 ...
-
bioRxiv - Immunology 2020Quote: ... naïve T cells were freshly isolated and subsequently cultured for 4/5 days in RPMI (Merck), containing 10% Heat Inactivated FCS (Invitrogen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 µL 0.2 µg/mL 4’,6’-diamidino-2-phenylindole (DAPI, Merck, catalog no. D9542) in PBS was added for 15 min at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 10% 2-mercaptoethanol at a 4:1 ratio (Merck, Sigma-Aldrich, cat. M6250) and heated at 55 °C for 7 min ...