Labshake search
Citations for Merck :
201 - 250 of 2532 citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... which were subsequently functionalized using 3-aminopropyl triethoxysilane (APTES, Merck). For this ...
-
bioRxiv - Plant Biology 2024Quote: ... an inhibitor of the HIS3 reporter gene (3-AT; Merck), were added to avoid leakage of the HIS3 gene (Castrillo et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... mouse anti-Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)-peroxidase (69295, Merck); anti-rabbit immunoglobulin G (IgG) ...
-
bioRxiv - Biophysics 2024Quote: ... Casein substrate (CAS: 9005-46-3) was bought from Merck and EnzChek casein BODIPY from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... each coverslip was washed with PBS 3 times each for 5 minutes and nuclei were stained with Hoechst (Merck Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was supplemented with calcium chloride to a final concentration of 3 mM and chromatin was solubilised for 2 h at 4 °C by digestion with Turbonuclease (T4330, Merck) to a final concentration of 250U/ml ...
-
bioRxiv - Microbiology 2024Quote: ... LS-ARS2 overnight culture was inoculated (1% v/v) in MRS broth adjusted to pH 4 and pH 3 with HCl (1N, Merck), followed by incubation for 0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dried pellet was mixed with Lysis buffer (9M urea, 4 wt% CHAPS, 2% Pharmalyte carrier ampholyte pH 3-10, Merck) and left overnight at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Cell Biology 2020Quote: ... grids were treated with 2.5 units/μl benzonase (Merck, 71206-3) in PBS/2mM MgCl2 for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... followed by 3 x washes with phosphate buffered saline (PBS; Merck). After fixation ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 mM Mg acetate (#63052, Sigma, part of Merck, Darmstadt, Germany), 2 mM EDTA (#AM9260G ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were then treated with 3 μM TAK-242 (Merck Millipore) or vehicle control (0.1% DMSO in final ...
-
bioRxiv - Physiology 2020Quote: ... 3.) C + 0.3 g/kg vitamin E (Merck KGaA, Darmstadt, Germany) (vit E diet) ...
-
bioRxiv - Microbiology 2020Quote: ... The bacterial cells were then fixed with 3% glutaraldehyde (Merck, Germany) in sodium phosphate buffer (0.1 M ...
-
bioRxiv - Immunology 2021Quote: ... washed 3× 10 min and developed using Millipore Crescendo ECL (Merck).
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... G3PDH activity was determined as glycerol-3-phosphate (G3P) (Merck, Germany) dependent reduction of DCIPIP at 600 nm (extinction coefficient 20.7 mM-1 cm-1 ...
-
bioRxiv - Genomics 2023Quote: Saccharomyces cerevisiae S288C genomic DNA (69240-3) was purchased from Merck, Gillingham ...
-
bioRxiv - Immunology 2022Quote: ... Endogenous peroxidase was blocked 10 min in 3% H2O2 (Merck, 107209) washed and then blocked in 1% bovine serum albumin in TBS-T for 10 min ...
-
bioRxiv - Biochemistry 2023Quote: ... concentrated using Amicon Ultracentrifugal filters with MWCO of 3 kDa (Merck), aliquoted ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3 h or with 100 ng/ml nocodazole (M1404, Merck) for 6 h ...
-
bioRxiv - Microbiology 2024Quote: ... and complete miniprotease inhibitor cocktail (Merck, UK, catalogue # 200-664-3). Protein extraction from raft culture was carried out by adding a small amount of liquid nitrogen to the tissue and grinding to a powder in a mortar and pestle ...
-
bioRxiv - Biochemistry 2024Quote: ... 4mM MgCl2 using Amicon Ultra Centrifugal Filter (3 kDa MWCO, Merck) for five times.
-
bioRxiv - Synthetic Biology 2024Quote: ... 1.62 µM H3BO3 (Merck/Sigma-Aldrich, CAS number : 10043-35-3), 0.08 µM MnCl2·4H2O (Merck/Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... 14: NI media supplemented with 3 mM CHIR (Merck, cat. #: 361571), Days 16 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µM Carbonyl cyanide 3-chlorophenylhydrazone (CCCP; Merck, Cat. #C2759, Germany), 1 µM rotenone (Merck ...
-
bioRxiv - Biochemistry 2024Quote: ... concentrated using 3 kDa cutoff Amicon Ultra Centrifugal Filters (Merck Millipore). Fractions were then applied to a HiPrep 16/60 Sephacryl S-100 gel filtration column using an Akta Start chromatography system (GE Biosciences ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sections were washed 3×10 minute PBS + 0.05% Tween-20 (MERCK) washes ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...