Labshake search
Citations for Merck :
201 - 250 of 3358 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... Oil Red O (Sigma-Merck, Germany) dye was used for staining lipids ...
-
bioRxiv - Cell Biology 2022Quote: ... 80 μM o-phenantroline (Merck,131,377), 1.5 μM pepstatin A (Merck ...
-
bioRxiv - Cell Biology 2020Quote: ... washed in PBS and incubated for 2 min in 2 mM H2O2 (Merck) at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... or 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck).
-
bioRxiv - Cell Biology 2023Quote: ... or 2-deoxy-glucose (2-DG; 500 μg/g) (25972, Merck Life Sciences) were injected IP at Day 0 ...
-
bioRxiv - Cell Biology 2024Quote: ... The coverslips were rinsed with 100% methanol before being functionalised in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... and beta-mercaptoethanol (Merck, M6250) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... pericarp sections were incubated for 2 h in a 5% (v/v) Normal Donkey serum (NDS; Merck) blocking solution in MTSB ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Biophysics 2022Quote: The dyes used in this study and the working dilutions were: 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine (LAURDAN, 4.5 μM, Sigma-Aldrich, Merck, #40227), Hoechst 33342 (80 uM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM 2-mercaptoethanol) supplemented with a protease inhibitor cocktail (cOmplete, Sigma-Aldrich/Merck). Cell extracts were injected into a Ni Sepharose column for affinity chromatography purification followed by size exclusion chromatography of the RnlA-mutant–containing fractions as a final step ...
-
bioRxiv - Immunology 2020Quote: 2-5.105 cells were incubated for 2 h with different concentrations of H2O2 (Merck) or for 2 ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to adding the cells.
-
bioRxiv - Microbiology 2022Quote: ... 2 ml/well of overlay [MEM containing 2% FBS and 0.4% tragacanth (Merck, Israel)] was added to each well and plates were incubated at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Neuroscience 2024Quote: ... for 180 min prior to washing and development in Streptavidin-tertiary reagent (1:500 in 2% BSA and 0.1% Triton [TBS]) conjugated to either Cyanine 3 (Cy3) (Merck) or Alexa Fluor 488 (Life technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 × 106 CGNs were mixed with 2 μg of a Mission shRNA vector for Snph (TRCN0000201959, Merck, Darmstadt, Germany) or pLKO.1-TRC-control (Addgene_#10879 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x phosphatase inhibitor 2 (Merck) and 1x phosphatase inhibitor 3 (Merck) ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli Rosetta 2 cells (Merck) by induction with 0.2 mM isopropyl β-d-1-thiogalactopyranoside for 18 h at 18 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... L-glutamine (2 mM; Merck), β-mercaptoethanol (50 µM ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg/ml U18666A (Merck) or vehicle (DMSO only ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitor cocktail–2 (Merck) at 1% (v/v) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 CaCl2 (Merck KGaA) at pH 7.4 ...
-
bioRxiv - Neuroscience 2020Quote: ... WO-2 MABN10 (Merck Millipore). Membranes were washed ...
-
bioRxiv - Cell Biology 2021Quote: ... Dithiothreitol (DTT; 2 mM; Merck). The lysate was cleared by centrifugation (18 000 g for 8 min at 4 °C) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µl Benzonase (Merck-Millipore) and sonicated for 45 min (intervals ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mM CaCl2 (A862982, Merck), 1 mM MgCl2 ...
-
bioRxiv - Immunology 2023Quote: ... and 2 units thrombin (Merck)/mg SCT protein previously measured by mouse-IgG-Fc-based sandwich ELISA following an overnight incubation at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 µM ubiquinone-2 (Merck) and 0.01-0.05 µM RC-LH1 in a buffer mixture containing 50 mM Tris ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mM CaCl2 (Merck; 1023780500), 1 mM MgCl2 (Merck ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 2 mM L-glutamine (Merck), 5 μg/ml human insulin (Merck) ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mM MgCl2 (1.05833.0250, Merck), 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 mM EDTA (Merck). Isolated cells were passed through a 70 μm cell strainer (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2024Quote: ... Centrin-2 (Merck, clone 20H5).
-
bioRxiv - Neuroscience 2024Quote: ... 2 μL Benzonase (E1014, Merck) in 1 mL sample was added ...
-
bioRxiv - Microbiology 2024Quote: ... 50 μM 2-mercaptoethanol (Merck), 2.5 μg/mL Insulin (Merck) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 mM L-glutamine (Merck), 100 units/L penicillin ...
-
bioRxiv - Biochemistry 2024Quote: ... 2% (w/v) glucose (Merck), 2% (w/v ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.