Labshake search
Citations for Merck :
201 - 250 of 5373 citations for 1 4 Bis acetyloxy 3 dodecylsulfanyl 2 naphthyl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Microbiology 2023Quote: ... K2HPO4 2.9 g/L, VWR; di-ammonium citrate 0.7 g/L, Sigma-Aldrich; sodium acetate 0.26 g/L, Merck; glucose 1% (w/v), Merck ...
-
bioRxiv - Microbiology 2023Quote: ... K2HPO4 2.9 g/l, VWR; di-ammonium citrate 0.7 g/l, Sigma-Aldrich; sodium acetate 0.26 g/l, Merck; glucose 1% (w/v), Merck ...
-
bioRxiv - Cancer Biology 2024Quote: ... The extracted 212Pb in 0.1 M HCl obtained from the emanation generator was adjusted to pH 5-6 with 5 M sodium acetate (Merck, Darmstadt, Germany) and mixed with TCMC-mAbs with specific activities of 1-50 MBq/mg ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Biophysics 2024Quote: ... The 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck (Darmstadt, Germany). Cholesterol (Chol ...
-
bioRxiv - Immunology 2023Quote: ... or 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck).
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 µL 0.2 µg/mL 4’,6’-diamidino-2-phenylindole (DAPI, Merck, catalog no. D9542) in PBS was added for 15 min at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... mice received 0.2% (w/w) cuprizone (Bis(cyclohexanone)oxaldihydrazone (C9012, Merck) added to grinded powder food or to food pellets (Envigo) ...
-
bioRxiv - Molecular Biology 2022Quote: ... For spore germination BMM with 60 mM ammonium acetate (Merck, Darmstadt, Germany; 1116.1000) was used ...
-
bioRxiv - Developmental Biology 2020Quote: ... A GnRH antagonist (0.25 mg of Cetrorelix acetate, Cetrotide®, Merck Serono, Spain) was administered daily from day 6 of stimulation (for donors ...
-
bioRxiv - Immunology 2020Quote: ... Phorbol-myristate-acetate (20.0 ng/ml) and ionomycin (500.0 ng/ml) (Merck, Austria) were added to the wells after five days ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μg/mL phorbol 12-myristate 13-acetate (PMA) and Ionomycin (Merck) to corresponding positive control wells ...
-
bioRxiv - Plant Biology 2022Quote: ... Following that 1ml of ice-cold ethyl acetate (Art. 864, Merck, Darmstadt, Germany) was added to the samples and stored overnight at −20°C ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... pH 7.0 (10min in the dark) followed by Methylcellulose/Uranyl Acetate (Merck UK) embedding (10min on ice in the dark) ...
-
bioRxiv - Biochemistry 2024Quote: ... Ammonium acetate and aminomethane were from Aldrich (now Merck Life Sciences, Madrid, Spain). L-Malic acid ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... excess media was removed from wells and mf were incubated with 0.5 mg/ml MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Merck) in PBS at 37°C for 90 min ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to adding the cells.
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µM Carbonyl cyanide 3-chlorophenylhydrazone (CCCP; Merck, Cat. #C2759, Germany), 1 µM rotenone (Merck ...
-
bioRxiv - Bioengineering 2023Quote: ... The 1.5 ml resuspended RBCs were cultured in 50 ml HPS containing 2 mM CaCl2 and 2 µM calcium ionophore-4-bromo-A23187 (C7522, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) in T75 flasks in a 5% CO2 incubator at 37°C for 16 h ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 μl 0.2 μg/ml 4’,6’-diamidino-2-phenyl-indole (DAPI, Merck, catalog no. D9542) in PBS was added for 15 min at RT ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: For GC-MS analysis all the samples were derivatized with N,O- Bis(trimethylsilyl) trifluoroacetamide with 1% trimethylchlorosilane (BSTFA) purchased from Merck (Darmstadt, Germany).
-
bioRxiv - Developmental Biology 2020Quote: ... 1% penicillin-streptomycin and 0.00035% 2-mercaptoethanol (Merck)) to an orbital shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of 1 M DTT (Merck, D9779) was added and the sample was heated for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... the MEK1/2 inhibitor PD0325901 (1 μM, Merck), LDN-193189 (100 nM ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 % Triton-X and 1x BugBuster (Merck Millipore, #70584-4) were added to lyse the bacteria for 30 min at 4 °C with gentle rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM TCEP with 4% SYPRO Orange dye (Merck, #S5692) were filtered in SpinX tubes (Corning ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Plant Biology 2020Quote: ... Purification by silica gel column chromatography (Kieselgel 60, Merck, n-hexane-ethyl acetate stepwise), semi-preparative normal-phase HPLC (Inertsil SIL-100A ...
-
bioRxiv - Plant Biology 2020Quote: ... Purification by silica gel column chromatography (Kieselgel 60, Merck, n-hexane-ethyl acetate stepwise) and semi-preparative HPLC (Inertsil SIL-100A ...
-
bioRxiv - Biochemistry 2021Quote: ... ammonium acetate and ethanol were obtained from Merck (Merck & Co. Inc., Kenilworth, NJ, USA). Lipid internal standards used in the study ...