Labshake search
Citations for Merck :
201 - 250 of 3899 citations for 1 1 Ethynylcyclohexyl azetidin 1 ium 3 yl n naphthalen 1 ylcarbamatechloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... the cells were incubated for 1 hour with 1% BSA blocking solution containing DAPI at 1:4,500 (Merck Life Sciences, Cat #: D9542), phalloidin at 1:350 (Merck Life Sciences ...
-
bioRxiv - Neuroscience 2022Quote: Small and large intestines were dissected from E14 embryos and digested with 1 mg/ml DNAse 1 (AppliChem A3778) and 1 mg/ml collagenase A (Merck Millipore 10103586001) in DMEM-F12 at 37 °C while shaking ...
-
bioRxiv - Physiology 2024Quote: ... Rabbit α-mouse Calmodulin (5μg mL-1, CellSignaling), rabbit α-mouse β-actin (1μg mL-1, CellSignaling) and mouse α-mouse GAPDH (1μg mL-1, Merck/Millipore), goat-α-mouse IRDye 680RD ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Biochemistry 2024Quote: ... ROS quenching was carried out by treating cells with 5 mM N-acetyl cysteine (NAC) (616-91-1, Merck) for 1 h.
-
bioRxiv - Biochemistry 2023Quote: ... coli pellet in 7.5 mL of TBS- N (Tris buffered saline with 0.1% NP-40) and supplemented with 1 x protease inhibitor cocktail tablet (Merck). Cells were sonicated for four rounds of one minute on ...
-
bioRxiv - Microbiology 2022Quote: ... and protein expression was induced O/N with 0.5 mM isopropyl 1-thio ß-D-galactopyranoside (IPTG) (Merck Chemicals). The next day ...
-
bioRxiv - Cell Biology 2024Quote: ... The obtained residue was derivatized with N-trimethylsilylimidazole/ trimethylchlorosilane reagent (TMSI:TMCS, 99:1, v/v; 50uL; both from Merck) and pyridine (50uL ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Immunology 2021Quote: ... Enriched HSPC-pDCs were then primed for 1-3 days in RF10 (RPMI-1640 medium (Merck) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... Acetylated histone 3 was detected using a polyclonal rabbit antibody (Merck, 06-599, 3260200, 1:500) and visualized using a donkey anti-rabbit Alexa Fluor 488 secondary antibody (Molecular Probes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng G-CASE and 3 mL PEI solution (1 mg/mL) (Merck KGaA, Darmstadt, Germany). 100 µL transfected cells were seeded per well onto 96-well plates (Brand ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM DTT) using Amicon Ultra-15 3 K or 30 K centrifugation units (Merck Millipore). The phase separation assay was performed in the presence or absence of 10% polyethylene glycol 8000 (PEG-8000 ...
-
bioRxiv - Plant Biology 2021Quote: ... the sections were incubated in 1× PBS containing 1% (1:100 dilution) mouse monoclonal anti-Flag M2 primary antibody (Merck, cat. no. F1804) and 0.1% (w/v ...
-
bioRxiv - Biophysics 2020Quote: ... Primary antibodies used to image centrioles in expanded RPE-1 cells were rabbit anti-polyglutamate chain (polyE), pAb (IN105, 1:250) and mouse monoclonal anti-acetylated tubulin (Merck, T7451, 1:500). Secondary antibodies were goat anti-Rabbit Alexa488 (Thermo-Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: Multiple rounds of sequential extraction (initially by hexane/dichloromethane (1:1 v/v) (Merck, Germany ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:100 protease inhibitor cocktail and 1 mM Phenylmethylsulfonyl Fluoride (PMSF; all from Merck). Equal amounts of protein (40 μg ...
-
bioRxiv - Immunology 2021Quote: ... or 1 h with rabbit polyclonal anti-GAPDH antibody (1:3000, ABS16, Merck Millipore) followed by incubation with respective HRP-conjugated secondary antibodies (G21040 ...
-
bioRxiv - Microbiology 2023Quote: ... phage stock was treated with 1 µL DNase I (10 U µL−1) (Merck) and 1 μL RNase A (10 U µL−1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% streptomycin and 2 mM of Glutamax and 0.1 μg·ml−1 GDNF (#SRP3200, Merck) (Vyas et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μl AAV virus was mixed with 1 μl 20% mannitol (MERCK K93152782 111). The virus and mannitol mixture were injected into a pulled-glass pipette (Warner Instruments ...
-
bioRxiv - Genetics 2023Quote: ... and crosslinked with 1% formaldehyde in PBS buffer containing 1 mM Pefabloc SC (Merck), Complete proteinase inhibitor cocktail (Merck) ...
-
bioRxiv - Microbiology 2023Quote: ... fixed cells were incubated with 1× PBS containing 1% bovine serum albumin (Merck KGaA) for 1 hour on ice ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... with secondary antibodies diluted in blocking solution with 1% Hoechst 33258 (1:100, Merck). After three times washing with PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human kindlin2 (mouse monoclonal, 3A3, Merck, MAB2617; WB 1:1000, IF 1:200), anti-mouse kindlin2 (rabbit polyclonal ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies used included mouse monoclonal antibodies against Tau-1 (1:1000; AB5622, Merck) or α-tubulin (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse monoclonal anti-APC (CC1; 1:100; clone CC-1; ref. OP80, Merck Millipore). Slices with primary antibodies were washed three times in PBS and incubated in secondary antibodies coupled ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bound TSP-1 was detected using a mouse anti-human TSP-1 (Merck, MABT879) antibody for 2 h at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mM TCEP and 1 x protease inhibitor cocktail (cocktail III Merck calbiochem, 535140). Cells were then lysed using an Emulsiflex (Emulsiflex-C5 ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal anti-α-tubulin clone B-5-1-2 (Merck T5168; 1:5000), mouse monoclonal anti-EF-18 clone A-5 (Santa Cruz Biotechnology sc-393731 ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 mM MgCl (Merck KGaA), pH 8.1) ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 mM MgCl (Merck KGaA), pH 8.1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 mM sodium pyruvate (Merck), and 50 mg/mL Kanamycin (BioConcept) ...
-
bioRxiv - Biophysics 2021Quote: ... and 1 % deoxycholic acid (Merck) in 50 mM Tris pH 8.0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 U/μl benzonase (Merck) was added ...
-
bioRxiv - Genetics 2021Quote: ... 1 mM Dithiothreitol (DTT, Merck), 0.5 mM Phenylmethanesulfonyl fluoride (PMSF ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX9 (1: 500, Merck, AB5535), LAMP3 (1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... proSFTPC (1:1000; Merck, AB3786), mature SFTPC (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-FAM21 (Merck, 1:1000), anti-phalloidin- TRITC (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... SOX9 (1: 1000, Merck, AB5535) and β-Actin (1 ...
-
bioRxiv - Biophysics 2020Quote: ... Thymidine (Merck, T1895, 1 mM) and Centrinone (Lucerna-Chem ...
-
bioRxiv - Developmental Biology 2021Quote: ... proSPC (1: 500, Merck, AB3786). After washing off the primary antibodies ...
-
bioRxiv - Cell Biology 2021Quote: ... ± Dox (1 µg/mL; Merck). Biotinylated antibodies and Anti-Biotin MicroBeads (Miltenyi ...
-
bioRxiv - Bioengineering 2020Quote: ... VGLUT1 (1:200, Merck, AMAB91041), rat monoclonal anti-Dopamine Transporter ...
-
bioRxiv - Bioengineering 2020Quote: ... Tuj1 (1:200, Merck, MAB1637), chicken polyclonal to tyrosine hydroxylase ...
-
bioRxiv - Cell Biology 2021Quote: ... actin (Merck, A2066, 1:4000). Secondary antibodies (all from Santa Cruz Biotechnology ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 mM PMFS (Merck, P7626), 1 mg/mL aprotinin (Carl-Roth ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked in 1% H2O2 (Merck) and incubated with 1 % normal Serum (Vector PK6200 ...