Labshake search
Citations for Merck :
2151 - 2200 of 2773 citations for Mouse anti Plasmodium vivax CSP PVC 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2024Quote: ... U-937 cells were maintained in RPMI-1640 medium supplemented with 4.5 g/L glucose, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1.0 mM sodium pyruvate (Sigma-Aldrich; Merck KGaA), 10% fetal bovine serum (Hyclone ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nuclei pellet was washed once in 5 mL of Honda buffer then purified on a Percoll density gradient as follows: 2 mL of 75% Percoll (Merck, P7828) in Honda buffer topped with 2 mL of 40% Percoll in Honda buffer topped with the nuclei pellet resuspended in Honda buffer in a 15 mL tube ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfectants with stably integrated GOI were then selected based on their resistance to G418 (0.5 mg/ml, 1-2 weeks, Merck, Cat.N. G8168). To induce the expression of the GOI the cells were treated with doxycycline (2 μg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and incubated at 28°C shaking at 200 rpm for 2–3 h before plating on LB agar supplemented with 50 µg/ml Kanamycin (Merck Millipore). The plates were incubated for 2– 3 days at 28°C ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The routinely used growth medium was composed of yeast extract (1%(w/v)) (Fisher BioReagents™) and casein peptone (2%(w/v)) (Merck), and was supplemented with 2% (w/v ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: MDCK cells (2 x 105 cells) were cultured on polycarbonate Millicell culture plate inserts (12- mm diameter, 3-µm pore size; Merck Millipore) at 37°C under 5% CO2 atmosphere.
-
bioRxiv - Developmental Biology 2023Quote: Cells were homogenized in 20 mM Tris-HCl buffer (pH 7.2, 0.2 mM EGTA, 5 mM β-mercaptoethanol, 2% (v/v) antiprotease cocktail (Merck KGaA, Germany), 1 mM PMSF ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Neuroscience 2024Quote: ... the elution of the biotinylated proteins was carried out boiling the beads in 25 μl of 3X protein loading buffer supplemented with 20 mM DTT and 2 mM Biotin (Merck, B4501) for 10 min at 95°C in gentle shaking ...
-
bioRxiv - Microbiology 2024Quote: ... ParT (S48C)-His6 and ParT (Q271C)-His6 aliquots were supplemented with 1 mM tris (2-carboxyethyl) phosphine hydrochloride (Merck; cat# C4706) before flash-freezing in liquid nitrogen.
-
bioRxiv - Molecular Biology 2020Quote: ... 600 µg WCL was mixed with anti-Flag antibody beads (Merck) at 4°C for 3 hr with rotation ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-SOX9 rabbit antibody (#AB5535-25UG, 1:200 dilution, Merck Millipore), Alexa Fluor 546-conjugated goat anti-rat IgG (H+L ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then stained for vinculin using anti-vinculin antibody (Merck Millipore ...
-
bioRxiv - Developmental Biology 2022Quote: ... and rabbit anti-phospho-histone H3 antibodies (Merck Millipore, 06-570), respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... The hybridized probes were detected with anti-Dig AP (Merck, #11093274910) and CDP-Star (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... The following antibodies and concentrations were used: anti-GAPDH (Merck #MAB374) 1/5,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti phospho-ubiquitin (Ser65) (Merck Millipore, ABS1513-I, 1:1000), mouse anti GAPDH (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... and rabbit anti-peripherin (1/500, Merck Millipore, AB1530, RRID: AB_90725). The analyses of L1-L5 and C4-C8 wild-type DRG were performed at different times ...
-
bioRxiv - Plant Biology 2021Quote: ... and mixed with 20 μl anti-FLAG magnetic beads (Merck Millipore). Following 1 hr ...
-
bioRxiv - Plant Biology 2021Quote: ... and mixed with 20 μL anti-MyC magnetic beads (Merck Millipore). Following 1 hr incubation at 4 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... and anti-GluN2A monoclonal antibody (1:1000; Merck KGaA, Darmstadt, Germany). After three washes in TBS-T ...
-
bioRxiv - Neuroscience 2020Quote: ... The antibody aggregates consisted of goat anti-biotin (#B3640; Merck, Germany) and STAR635P-conjugated donkey anti-goat (#ST635P ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-OC against high molecular weight Aβ (Merck Millipore, Sweden), mouse anti-6E10 for human Aβ/APP (BioLegend ...
-
bioRxiv - Neuroscience 2022Quote: ... we used a goat anti-ChAT (1/100; Merck-Millipore, France) or a mouse anti-islet 1,2 (1/250 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then stained with DAPI anti-fade mounting media (Merck). For 1,6-Hexanediol (HD ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were: rabbit anti-TH (1:1000, Merck Millipore, #AB152), anti-mouse anti-Cre (1:500 ab24607) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The western blot was performed using anti-puromycin (1:1000, Merck) and anti-mouse-horseradish peroxidase (1:5000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-phospho-Histone H2A.X Ser139 (γH2AX, clone JBW301, Merck Millipore, USA) or anti-53BP1 antibody (H-300 ...
-
bioRxiv - Immunology 2020Quote: ... were coated respectively with anti-AKT (clone SKB1, Merck Group, Germany) or anti-PTPN22 (clone D6D1H ...
-
bioRxiv - Neuroscience 2019Quote: ... at 1:500 or polyclonal rabbit anti-Prox1 antibody (Millipore; Merck KGaA ...
-
bioRxiv - Physiology 2019Quote: ... Antibodies used were rabbit anti-MCT4 (1:250; AB3314P, Merck Millipore), mouse anti- β-actin (1:2,000 ...
-
bioRxiv - Genetics 2020Quote: ... Protein extraction and Western blot using anti-puromycin antibody (Merck Millipore) was performed as described before.
-
bioRxiv - Cell Biology 2021Quote: ... anti-Tau-1 antibody (non-phosphorylated Tau, clone PC1C6, MERCK, MAB3420), Tau monoclonal antibody (TAU-5 ...
-
bioRxiv - Physiology 2020Quote: ... rabbit polyclonal anti-phospho CREB1 conjugate (06-519-AF647, Merck, Germany) and rabbit polyclonal activating transcription factor-4 (ATF4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant rabbit anti-pan-ADP-ribose binding reagent MABE1016 (Merck Millipore) was used 1:1000 ...
-
bioRxiv - Plant Biology 2021Quote: ... and α-MAR/PAR (anti-pan-ADP-ribose binding reagent, Merck). Proteins were detected using HRP-coupled secondary antibodies and X-ray films.
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-COLLAGEN type IV (cat. # AB756P, Merck Millipore, 1:500), mouse anti-Neurofilament (cat ...
-
bioRxiv - Neuroscience 2019Quote: ... or rabbit anti-tyrosine hydroxylase antibody (1:1000, AB152, Merck, Germany) overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Adjacent sections were immunolabelled with anti-NeuN (1:150, MAB377 Merck).