Labshake search
Citations for Merck :
2151 - 2200 of 5132 citations for 6 Pteridinepropanoic acid 2 4 diamino α 4 methoxycarbonyl phenyl α 2 propyn 1 yl methyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 5 µg 17:0 free fatty acid (Merck, Germany) was used as the internal standard ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were split into either 6 well-plates (300000 cells per well) coated with 1 mg/ml Poly-L- Lysine (PLL, Merck, P9155) for western blotting ...
-
bioRxiv - Microbiology 2020Quote: ... One hundred mL of sewage samples were filtered with a 0.22-μm-pore-size mixed cellulose ester membrane (Merck Millipore, Billerica, MA, USA). DNA was extracted from the filtered membranes and from 150–200mg of the nonhuman fecal samples using the ZR Fecal DNA MiniPrep™ Kit (Zymo Research ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Neuroscience 2021Quote: ... brains were quickly removed from the skull and snap frozen at −25°C in isopentane (2-Methylbutane, Merck Life Science, Italy). Once frozen ...
-
bioRxiv - Developmental Biology 2022Quote: ... Organoid cells were cultured in self-renewing medium with ROCKi for 8 days before Dox (Doxycycline hyclate, 2 µg/ml, Merck, D9891) and TMP (Trimethoprim ...
-
bioRxiv - Immunology 2021Quote: ... Color was developed in the dark for 5-10 min before adding 50 µL of 2 M H2SO4 stop solution (Merck, Germany). Optical density was read at wavelength 450 nm using the microplate reader (SpectraMax ID3 ...
-
Trypanosoma brucei J protein 2 functionally cooperates with the cytosolic Hsp70.4 and Hsp70 proteinsbioRxiv - Molecular Biology 2019Quote: ... 2 mM MgCl2) or into the appropriate assay buffer for functional studies and then subsequently concentrated against PEG 20000 (Merck, Germany). The protein yield was estimated using the Bradford assay (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2019Quote: ... Pelet was dissolved in 2 ml DDW and passed through a 0.2-μm membrane filter (Millex-GV Filter Unit, Merck Millipore, Ireland). The filtrate was used for sucrose ...
-
bioRxiv - Neuroscience 2020Quote: ... a buffer suitable to investigate aggregates resistance to digestion (detailed below) and 2) the SysQuant Buffer (8M urea, phosphatase inhibitor (PhosSTOP™, Merck) and protease inhibitor (cOmplete™ ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... PAb directed against phospho-STAT2 (Tyr689) and MAb directed against human IFNα/β receptor chain 2 (MAB1155) were purchased from Merck-Millipore.
-
bioRxiv - Bioengineering 2021Quote: Unbound DNA was removed from DNA-SWCNT samples prepared by direct sonication and MeOH-assisted surfactant exchange by rinsing with Amicon centrifugal ultra-filtration devices (Amicon Ultra-2, Sigma Aldrich, 100 kDa membrane, Merck), as detailed above ...
-
bioRxiv - Bioengineering 2021Quote: ... and GEES protein fractions (2-16 µg) were processed by the MED-FASP protocol using Microcon 30k centrifugal ultrafiltration units (Merck, Darmstadt) [11] ...
-
bioRxiv - Biochemistry 2020Quote: ... Next the medium was replaced with a serum-free media supplemented with 2 nM brain-derived neurotrophic factor (BDNF) (Merck Millipore). After 2 days in the BDNF-containing media ...
-
bioRxiv - Neuroscience 2020Quote: The barrier integrity of the in vitro BBB models was assessed through measurements of TEER using Millicell ERS-2 epithelial volt-ohm Meter and STX01 Chopstick Electrodes (Merck Millipore). The TEER value for each hanging culture insert was obtained from an average of three individual measurements subtracted the TEER value of a double-coated cell-free hanging culture insert and multiplied by the area of the hanging culture insert (1.12cm2) ...
-
bioRxiv - Plant Biology 2022Quote: CGMMV vsiRNAs were quantified by RT-qPCR according to Shi and Chiang (2005) with some modifications: 2 μg of RNA extracts from the cucumber leaves were treated with DNaseI (Merck, Spain) and polyadenylated using the Poly(A ...
-
bioRxiv - Immunology 2020Quote: PBMCs were rested overnight in complete medium and seeded at 2 × 105 cells/well in MultiScreen HTS Filter Plates (Merck Millipore) pre-coated with anti-IFN-γ (clone 1-D1K ...
-
bioRxiv - Physiology 2019Quote: Hearts from 5 mpf zebrafish were fixed with 2.5% glutaraldehyde (Agar Scientific, Stansted, Essex, UK) and 2% paraformaldehyde (Merck, Darmstadt, Germany) in 0.1 M Na-cacodylate-buffer (Merck) ...
-
bioRxiv - Microbiology 2020Quote: ... used for barrier dysfunction experiments were conducted on a 37 °C heating block using a Millicell ERS-2 Voltohmmeter (Merck-Millipore) equipped with an Ag/AgCl electrode (STX01) ...
-
bioRxiv - Molecular Biology 2021Quote: TEER measurements [22] were performed on 3rd day of incubation with growth factors and (or) different inhibitors by using Millicell ERS-2 Electrical Resistance System (Merck-Millipore). Each insert was measured in three different locations ...
-
bioRxiv - Plant Biology 2020Quote: ... samples were resuspended in Urea 7 M and Thiourea 2 M buffer and desalted on Amicon Ultra-0.5 3 kDa centrifugal filters (Merck Millipore, Germany). Filters were filled to maximum capacity with buffers and centrifuged at 15,000 g for 10 min at 20°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... we repeated the experimental protocol and behavioral battery in wild type zebrafish larvae using 2 μM THC (Merck, Cat. No. T4764), and 0.15 μM nicotine (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... Fractions containing the desired His6-tagged protein were concentrated to 2 ml using Amicon® Ultra Centrifugal Filters (10,000 MWCO, Merck Millipore), and were directly injected into a size-exclusion chromatography column (Superdex 75 16/60 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 2 μl of the enzyme β-glucuronidase (from Helix from Pomatia enzyme aqueous solution, ≥ 100.000 units/mL; Merck, Darmstadt, Germany) to deconjugate DEHP metabolites and BPA ...
-
bioRxiv - Immunology 2021Quote: ... tumors were enzymatically digested with 2,000 U/mL of DNase I and 2 mg/mL of collagenase IV (both from Sigma Aldrich, Merck, Israel) in HBSS for 30 min 37 □ ...
-
bioRxiv - Neuroscience 2021Quote: ... the kinetics of ROS production was evaluated for 2 h after the addition of 2,7-dichloro-diidrofluorescineacetate (DCFH-DA, Merck, Darmstadt, Germany) using the Microplate Reader GloMax fluorimeter (Promega Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fractions corresponding to the elution peak were selected and concentrated to 2-50 mg/mL through the use of Amicon® Ultra-15 Centrifugal Unit (Merck), frozen and stored at −80°C for downstream experiments ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 10 min at room temperature and stained with the Hemacolor Rapid Staining Kit (Merck Millipore). Images were collected on BX61 upright microscope (Olympus ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nuclei pellet was washed once in 5 mL of Honda buffer then purified on a Percoll density gradient as follows: 2 mL of 75% Percoll (Merck, P7828) in Honda buffer topped with 2 mL of 40% Percoll in Honda buffer topped with the nuclei pellet resuspended in Honda buffer in a 15 mL tube ...
-
bioRxiv - Plant Biology 2023Quote: ... and incubated at 28°C shaking at 200 rpm for 2–3 h before plating on LB agar supplemented with 50 µg/ml Kanamycin (Merck Millipore). The plates were incubated for 2– 3 days at 28°C ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Microbiology 2023Quote: MDCK cells (2 x 105 cells) were cultured on polycarbonate Millicell culture plate inserts (12- mm diameter, 3-µm pore size; Merck Millipore) at 37°C under 5% CO2 atmosphere.
-
bioRxiv - Developmental Biology 2023Quote: Cells were homogenized in 20 mM Tris-HCl buffer (pH 7.2, 0.2 mM EGTA, 5 mM β-mercaptoethanol, 2% (v/v) antiprotease cocktail (Merck KGaA, Germany), 1 mM PMSF ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Neuroscience 2024Quote: ... the elution of the biotinylated proteins was carried out boiling the beads in 25 μl of 3X protein loading buffer supplemented with 20 mM DTT and 2 mM Biotin (Merck, B4501) for 10 min at 95°C in gentle shaking ...
-
bioRxiv - Plant Biology 2024Quote: ... Blots were blocked for 1 hours at 21°C or overnight at 4°C with 5% (w/v) skim milk in PBS-T (PBS tablets; Merck 524650, 0.1% Tween-20; Merck P1379). The membrane was incubated with 1:5000 anti-flagellin antibody (Taguchi et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... resuspended in 6 μL deionized formamide (Merck Life Science) per hybridisation ...
-
bioRxiv - Biophysics 2021Quote: ... 6×His-tagged recombinant MSP1E3D1 (Sigma-Aldrich, Merck, USA) and FLAG-tagged recombinant mCardinal (kindly provided by Jakub Czapiński ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with 6 mM CHIR99021 (Merck Millipore) in DeSR1 media containing DMEM/F12 1% MEM-NEAA (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... and finally dissolved in 6 M guanidine hydrochloride (Merck). 14.4.4 and H57 scFVs were refolded from inclusion bodies in vitro ...
-
bioRxiv - Developmental Biology 2024Quote: ... For each IVF session one epididymis from 12-week-old WT and one from Trim66-null were transferred into 90 μL of capacitation medium, consisting of TYH (Takeo & Nakagata, 2011) with 0.75 mM methyl-β-cyclodextrin (MBCD, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany). Spermatozoa were allowed to disperse from the tissue and incubated for 30 min in a 5% CO2 incubator at 37°C.