Labshake search
Citations for Merck :
2101 - 2150 of 2951 citations for Mouse Anti Dengue Virus Serotype 2 NS1 Antibody CM435 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed 2 twice with PBS and were permeabilized with PBS–0.06%-Triton X-100 (Merck, USA) for 10 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... medium was replaced with the culture medium containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Biophysics 2022Quote: ... for 2 hours at 37°C and purified using an Amicon 30 kDa MWCO filter (Merck, Darmstadt, Germany). Deep Vent exo-DNA polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: AKT1/2 phosphorylation was inhibited with InSolution™ Akt Inhibitor VIII (1-10 µM, Merck KGaA, Darmstadt, Germany) in FCS-free medium for 3 hours prior to treatment with HGF (10 ng/µl).
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Biophysics 2022Quote: Purified FHL was concentrated to 1-2 mg/mL using an Amicon centrifugal concentrator (100-kDa cutoff; Merck) and 3 µL of protein solution was applied to freshly glow-discharged C-flat 1.2/1.3 or 2/1 holey carbon grids (Protochips) ...
-
bioRxiv - Microbiology 2020Quote: ... Peptides were dissolved in 2% acetonitrile containing 0.1% trifluoroacetic acid and desalted using C18 ZipTips (Merck Millipore, Germany). Each sample was independently analysed on a Q-Exactive hybrid quadrupole-orbitrap mass spectrometer (Thermo Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Prior to sterilization pH of ASW was calibrated at 8.5 ± 0.5 through the addition of 2 M NaOH (Merck) solution ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL lipid extract was injected on a LiChroCART 250–4 LiChrospher® Si 60 (5 μm) (Merck) maintained at 25 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... and Click-iT® EdU (5-ethynyl-2’deoxyuridine) Assay (BCK-EDU488, baseclick GmbH, Merck/Sigma-Aldrich, UK), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... thawed pellet was resuspended into 20 ml lysis buffer (0.025 M Tris pH 8; 0.5 M NaCl; 2 mM MgCl2; 100 U/ml Benzonase (Merck); 0.25 mg/ml lysozyme (Roche) ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Cell Biology 2022Quote: ... cells pre-labeled with transferrin-Alexa Fluor 594 were treated for 2 hours with 10 μM SAR405 (Merck, cat ...
-
bioRxiv - Microbiology 2022Quote: ... concentrated to 2-10 mg/ml using Amicon concentration devices (Merck, 3,000 or 10,000 Da cut-off filter) and stored in aliquots at −80 °C until needed ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed three times in 0.1 M sodium cacodylate buffer pH 7.2 ± 0.1 containing 0.2 M sucrose and 2 mM MgCl2 (Merck Millipore), and adhered to 12 mm diameter round glass coverslips (Paul Marienfeld GmbH & Co ...
-
bioRxiv - Cell Biology 2022Quote: ... Pooled eluates were then concentrated approximately 40 times using a centrifugal filter (Amicon Ultra-2 10k, UFC201024, Merck Millipore ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... the mice were inoculated with 100,000 SB28-GFP cells suspended in 2 µl of DMEM (Merck, Darmstadt, Germany) (glioblastoma mice ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Microbiology 2023Quote: ... auris cells (CHRIST Alpha 1-2 LD plus lyophilizer, Osterode, Germany) using Tri Reagent (Merck Ltd. Budapest, Hungary). The quality of RNA was determined using the Eukaryotic Total RNA Nano kit (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were then induced for EmGFP-NSD3 expression with 2 μg/ml of doxycycline (D9891-1G, Merck) for 48 h ...
-
bioRxiv - Microbiology 2023Quote: ... A fraction of the inoculum was directly transferred into 2 ml tube containing TRI reagent (Sigma-Aldrich, Merck) and silica beads (0.1 mm diameter ...
-
bioRxiv - Biophysics 2023Quote: ... 5 and 10 μl of the lipid extract 2 cm from the bottom on aluminum-backed silica gel 60 TLC plates (cat#: 1.05553.0001; Merck) together with DOPG ...
-
bioRxiv - Molecular Biology 2022Quote: ... eggs rafts were hatched in trays containing 2 L of Milli-Q water (Synergy® UV, Merck, Germany). Larvae were fed continuously until the pupae stage with TetraMin® baby fish food (Tetra ...
-
bioRxiv - Molecular Biology 2023Quote: ... exponentially growing RPE-1 cells were pulse-labeled with 1 μM CldU (5-Chloro-2’-deoxyuridine, Merck, C6891) and 250 μM IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions were stopped with 2 µl of 0.5 M EDTA and separated using thin layer chromatography plates (Merck) with 0.3 M LiCl and 0.3 M formic acid as the mobile phase ...
-
bioRxiv - Biochemistry 2023Quote: The reaction mixtures (0.5, 1 or 2 µL) were spotted onto TLC Silica Gel 60 F254 plates (Merck). As for analysis of cyclization activity ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Human HepaRG hepatoma cells (1.5-2×105 cells/cm2, Biopredic International, Rennes, France) were cultured in William’s E medium (Merck) supplemented with 10% heat-inactivated FCS ...
-
bioRxiv - Zoology 2024Quote: ... The sample was then placed in 2 ml petroleum ether (boiling range 40-60°C, Merck, Darmstadt, Germany) at room temperature for two days ...
-
bioRxiv - Molecular Biology 2024Quote: ... The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck), respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... L-glutamine and antibiotic/antimycotics and decidualized with 1µM PGE2 or 1µM relaxin-2 (accession # P04090) (both Biotechne Ltd, Abbington, U.K.) in combination with 1µM medroxyprogesterone acetate (MPA) (Merck) for up to 4 days ...
-
bioRxiv - Cancer Biology 2024Quote: ... A total of 2 × 104 cells were cultured in an 8-well chamber slide (Merck Millipore, Massachusetts, USA) and then fixed with 4% paraformaldehyde in PBS buffer for 15 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... For IP with guinea-pig antibody protein A-conjugated magnetic beads (Merck Millipore, LSKMAGA10) were used ...
-
bioRxiv - Neuroscience 2019Quote: ... slices were rinsed and incubated with secondary antibody (dilution 1:500; AP182C, Merck Millipore) diluted in 1% BSA TBST for 1-2h ...
-
bioRxiv - Biochemistry 2020Quote: ... Primary antibodies were used as follows: GST (1:1,000 dilution; Cat # 27457701V) from Merck, ubiquitin (1:1,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... Secondary antibody solutions were supplemented with 1 µg/mL DAPI solution (MBD0015; Merck KGaA) and 1 µg/mL BODIPY™ 493/503 dye (D3922 ...
-
bioRxiv - Microbiology 2022Quote: AB19026 ADAM10 rabbit polyclonal antibody (Immunogen: hADAM10 peptide 732-748) was purchased from Merck; anti-ADAM10 IC1427F was from R&D ...
-
bioRxiv - Genomics 2019Quote: ... The cells were incubated with an antibody against 8-oxoG (Merck KGaA, Darmstadt, Germany) diluted 1:200 in 0.05% Tween 20 in PBS for overnight at 4 °C ...
-
bioRxiv - Immunology 2020Quote: Antibody secreting cells (ASCs) were assayed in Multiscreen HA plates (Merck Milipore, Molsheim, France) coated with DT (10μg/mL) ...
-
bioRxiv - Microbiology 2022Quote: ... Antibodies were detected using the enhanced chemiluminescence system (Immobilon Forte Western HRP substrate, Merck) on the Amersham Imager 600 (GE Health Care Life Sciences) ...
-
bioRxiv - Neuroscience 2022Quote: ... and a polyclonal antibody against detyrosinated tubulin (1:1000; AB3201, Merck Millipore, Darmstadt, Germany) were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... with secondary antibodies diluted in blocking solution with 1% Hoechst 33258 (1:100, Merck). After three times washing with PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... the membranes were stripped using ReBlot Plus Mild Antibody Stripping Solution (Merck, Darmstadt, Germany), washed ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were stripped with 1X ReBlot Plus Strong Antibody Stripping Solution (#2504, Merck Millipore), blocked for 30 minutes in blocking milk ...
-
bioRxiv - Biophysics 2024Quote: ... the antibody was concentrated with an Amicon spin filter (MWCO 100 kDa, Merck, Germany) when the antibody concentration was below 2 mg/mL ...
-
bioRxiv - Physiology 2021Quote: ... For colocalization 1:100 anti-NBCe1 was incubated with 1:1,000 anti-Clara Cell Secretory Protein (CCSP; Merck Millipore cat#07-623) or 1:200 anti-alpha tubulin (Santa Cruz cat#sc-5286 ...
-
bioRxiv - Cell Biology 2023Quote: Anti-Cortactin (p80/85) clone 4F11 (ref. n°05-180-I) and Anti-LAMP1 (ref. n°L1418) are from Merck (Sigma-Aldrich). Alexa FluorTM 488 Phalloidin (ref ...
-
bioRxiv - Physiology 2024Quote: ... For colocalization 1:100 anti-CHRM3 was incubated with 1:500 anti-Clara Cell Secretory Protein (CCSP; Merck Millipore cat#07– 623), 1:200 anti-alpha tubulin (Santa Cruz ...
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...