Labshake search
Citations for Merck :
2001 - 2050 of 2134 citations for Acyl protein thioesterase 2 LYPLA2 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... tumors were enzymatically digested with 2,000 U/mL of DNase I and 2 mg/mL of collagenase IV (both from Sigma Aldrich, Merck, Israel) in HBSS for 30 min 37 □ ...
-
bioRxiv - Neuroscience 2021Quote: ... the kinetics of ROS production was evaluated for 2 h after the addition of 2,7-dichloro-diidrofluorescineacetate (DCFH-DA, Merck, Darmstadt, Germany) using the Microplate Reader GloMax fluorimeter (Promega Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fractions corresponding to the elution peak were selected and concentrated to 2-50 mg/mL through the use of Amicon® Ultra-15 Centrifugal Unit (Merck), frozen and stored at −80°C for downstream experiments ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 5,000 Da ...
-
bioRxiv - Cell Biology 2022Quote: ... femurs and tibias of C57BL/6J mice were extracted and crushed on a mortar in PBS supplemented with 4%FBS and 2 mM EDTA and filtered through 0.45μm strainers (Merck Millipore, Cat#SLHV033RB). For B cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Plant Biology 2023Quote: ... and concentrated to 2 mg chlorophyll mL-1 using a 100-kDa molecular-weight cut-off centrifugal filter unit (Amicon Ultra-15, Merck Millipore). A 3 µl volume of the sample was applied to a glow-discharged holey carbon grid (GIG ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Zoology 2023Quote: ... it was fractionated into the different fatty acid classes over an activated silicic acid column (heated at 120ºC for 2 h; Merck Kieselgel 60) via eluting with 7 ml chloroform ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 10 min at room temperature and stained with the Hemacolor Rapid Staining Kit (Merck Millipore). Images were collected on BX61 upright microscope (Olympus ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfectants with stably integrated GOI were then selected based on their resistance to G418 (0.5 mg/ml, 1-2 weeks, Merck, Cat.N. G8168). To induce the expression of the GOI the cells were treated with doxycycline (2 μg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and incubated at 28°C shaking at 200 rpm for 2–3 h before plating on LB agar supplemented with 50 µg/ml Kanamycin (Merck Millipore). The plates were incubated for 2– 3 days at 28°C ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The routinely used growth medium was composed of yeast extract (1%(w/v)) (Fisher BioReagents™) and casein peptone (2%(w/v)) (Merck), and was supplemented with 2% (w/v ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: MDCK cells (2 x 105 cells) were cultured on polycarbonate Millicell culture plate inserts (12- mm diameter, 3-µm pore size; Merck Millipore) at 37°C under 5% CO2 atmosphere.
-
bioRxiv - Developmental Biology 2023Quote: Cells were homogenized in 20 mM Tris-HCl buffer (pH 7.2, 0.2 mM EGTA, 5 mM β-mercaptoethanol, 2% (v/v) antiprotease cocktail (Merck KGaA, Germany), 1 mM PMSF ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck, P5726-1ML and P0044-1ML, respectively) and 1:100 protease inhibitor cocktail (Sigma/Merck ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2024Quote: ... U-937 cells were maintained in RPMI-1640 medium supplemented with 4.5 g/L glucose, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1.0 mM sodium pyruvate (Sigma-Aldrich; Merck KGaA), 10% fetal bovine serum (Hyclone ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nuclei pellet was washed once in 5 mL of Honda buffer then purified on a Percoll density gradient as follows: 2 mL of 75% Percoll (Merck, P7828) in Honda buffer topped with 2 mL of 40% Percoll in Honda buffer topped with the nuclei pellet resuspended in Honda buffer in a 15 mL tube ...
-
bioRxiv - Biophysics 2019Quote: ... Constructs of Kmpv1 and KmpvSP1 were transiently expressed as fusion proteins with GFP on the C-terminus using the liposomal transfection reagent GeneJuice® (MERCK KGaA, Darmstadt, Germany). Measurements were performed at room temperature in a bath solution containing ...
-
bioRxiv - Bioengineering 2019Quote: ... 40 µg of total protein were run on a 12% SDS-PAGE and transferred onto a 0.45 µm Immobilon®-P Transfer Membrane (Merck Millipore, Cat. NO#IPVH00010). The membrane was hybridized with a custom antibody at a 1 µg/mL dilution (GenScript ...
-
bioRxiv - Microbiology 2022Quote: ... and proteins in the lysate were separated in a denaturing polyacrylamide gel and transferred to a polyvinylidene fluoride (PVDF) membrane (Merck Millipore, Burlington, MA, USA). The membrane was incubated with 5 % skim milk (BD Biosciences ...
-
bioRxiv - Genetics 2022Quote: ... 50 μg of protein was used for gel electrophoresis in 10-14% SDS-PAGE gels and transferred to PVDF membranes (Merck Millipore, Billerica, MA, USA). After blocking in 5% defatted milk ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... peptides (<3 kDa) were separated from high molecular size proteins by a 3 kDa cutoff ultrafiltration column (Amicon®, Merck Millipore Ltd., Cork, Ireland). The crude peptides (<3 kDa ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Peak fractions were analyzed for purity by SDS- PAGE and those containing pure tag free CBX8 protein were pooled and concentrated using Amicon Ultra-15 concentrators 3,000 molecular weight cut-off (Merck Millipore, Carrigtwohill Co. Cork IRL). Protein was exchanged into a buffer consisting of 20mM MES pH 6.5 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Peak fractions were analyzed for purity by SDS-PAGE and those containing pure protein were pooled and concentrated using Amicon Ultra-15 concentrators 10,000 molecular weight cut-off (Merck Millipore, Carrigtwohill Co. Cork IRL).
-
bioRxiv - Synthetic Biology 2021Quote: ... Peak fractions were analyzed for purity by SDS-PAGE and those containing pure protein were pooled and concentrated using Amicon Ultra-15 concentrators 3,000 molecular weight cut-off (Merck Millipore, Carrigtwohill Co. Cork IRL). Protein was exchanged into a buffer containing 25 mM Tris ...
-
bioRxiv - Immunology 2020Quote: Following protein digestion a 5% volume of the peptide solution was cleaned up with a reverse phase (C18) ZipTip (Merck Millipore, Burlington, MA, USA). The peptide sample was acidified with the addition of 1 μl 1M hydrochloric acid ...
-
bioRxiv - Immunology 2022Quote: ... Tissue samples for RNA-protein extraction were cut into small pieces (< 5 mm) and placed in a microcentrifuge tube containing RNAlater® solution (Merck Ltd, Dorset, UK) and stored at −70°C until further use.
-
bioRxiv - Microbiology 2023Quote: Proteins in the lysate were separated on a denaturing polyacrylamide gel and transferred to a polyvinylidene fluoride (PVDF) membrane (Merck Millipore, Burlington, MA, USA). The membrane was incubated with 5 % skim milk (BD Biosciences ...
-
bioRxiv - Neuroscience 2022Quote: ... We tested several markers to label myelinated axons and settled on using an antibody against myelin basic protein (MBP; Merck, NE1019-100UL, 1:1000). We used two different antibodies for both PV (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed 3 times in TBS before being probed with protein A-peroxidase (Merck, 1:50000 in 10% Skimmed Milk in TBS). The membrane was incubated with 1x LumiGLO® / 1x Peroxidase (CellSignal ...
-
bioRxiv - Cell Biology 2023Quote: ... the protein was concentrated to the desired concentration using centrifugal filters (#UFC800308; Amicon® Ultra centrifugal filters, Ultracel® −3K or larger; Merck Millipore Ltd.)
-
bioRxiv - Cell Biology 2023Quote: ... Gels were run in 1x running buffer and then the proteins were transferred from the gel in ice cold 1x Buffer onto Immobilon®-P Transfer membranes (Merck Millipore, Cat.No. IPVH00005). Transfer membranes were air dried to dehydrate and stored until use ...
-
bioRxiv - Microbiology 2024Quote: ... 15 µg of total protein in a volume of 47 µl 1x sample buffer was treated with 7 U of benzonase (#70746; Merck Millipore, Burlington, MA, USA) in dilution buffer (20 mM HEPES pH 8.0 ...
-
bioRxiv - Immunology 2024Quote: ... Equal amounts of protein were then separated through 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (Merck Millipore Ltd., Tullagreen, Ireland). Membranes were blocked in 5% nonfat dry milk in 1× TBST for 1 hour at room temperature ...