Labshake search
Citations for Merck :
151 - 200 of 6046 citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated for 10 minutes in 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000, Merck, Italy, D9542), to allow visualization of cell nuclei ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of Protein powder solutions (1 mg/ml) were added to 3 cm NG plates with 10 µM 5-FU (Merck, #F6627). After the plates had dried ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (#D9542, Merck. Darmstadt. Germany).
-
bioRxiv - Physiology 2022Quote: ... cultures were fixed with 4% PFA and stained with 2% Alizarin red S (Merck). For the quantification ...
-
bioRxiv - Developmental Biology 2024Quote: ... grids were post-stained with 2% aqueous uranyl acetate at pH 4 (Merck, Germany) and Reynold’s lead citrate ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 4 h with 5 mg/ml Brefeldin A (Merck, Darmstadt, Germany) after 140 h incubation time ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 0.15% 3-[(3- Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, Merck Chemicals Ltd.). NADH:decylubiquinone (DQ) ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Biophysics 2024Quote: ... The 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck (Darmstadt, Germany). Cholesterol (Chol ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Microbiology 2021Quote: ... Isolated lipids were dissolved in 30 μL of chloroform:methanol (2:1, v/v) and 5 μL loaded on thin-layer chromatography (TLC) silica gel plates F254 (Merck). Lipids were separated in chloroform/methanol/water (20:4:0.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... they were washed 3 times with 1X PBS for 5 minutes and incubated with DAPI (4’6-Diamidino-2-phenylindole; 1 µg/mL, MERCK) for 5 minutes ...
-
bioRxiv - Immunology 2020Quote: ... naïve T cells were freshly isolated and subsequently cultured for 4/5 days in RPMI (Merck), containing 10% Heat Inactivated FCS (Invitrogen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 µL 0.2 µg/mL 4’,6’-diamidino-2-phenylindole (DAPI, Merck, catalog no. D9542) in PBS was added for 15 min at RT ...
-
bioRxiv - Genetics 2020Quote: ... Bone tissue was cut into 2-mm pieces and placed in PBS buffer containing 4% paraformaldehyde (Schuchardt, Muenchen, Germany) and 1% glutaraldehyde (Merck, electron microscopy grade ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 50 µL chloroform : methanol (2 : 1) and 5 µL were loaded on silica gel 60 F254 plates (Merck). To separate trehalose esters of mycolates (TDM ...
-
bioRxiv - Biochemistry 2023Quote: ... membranes were blocked with 5% BSA in TSMT (20 mM Tris; 150 mM NaCl, Merck; 1 mM CaCl2, Sigma; 2 mM MgCl2, Merck; adjusted to pH 7 with HCl ...
-
bioRxiv - Bioengineering 2023Quote: ... The 1.5 ml resuspended RBCs were cultured in 50 ml HPS containing 2 mM CaCl2 and 2 µM calcium ionophore-4-bromo-A23187 (C7522, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) in T75 flasks in a 5% CO2 incubator at 37°C for 16 h ...
-
bioRxiv - Biochemistry 2020Quote: ... and a SeQuant ZIC-HILIC precolumn (5 μm particles, 20 × 2 mm) (Merck, Darmstadt, Germany) using a linear gradient of mobile phase A (5 mM NH4OAc in acetonitrile/H2O (5/95 ...
-
bioRxiv - Cell Biology 2021Quote: 6 μL of 70 kDa FITC-dextran in EGM-2 (5 mg/mL, Merck, #46945) was added to each vessel ...
-
bioRxiv - Immunology 2022Quote: ... Peritoneal cavity cells were obtained by lavage with 5 mL PBS + 2 mM EDTA (Merck). Following gentle massage ...
-
bioRxiv - Biochemistry 2024Quote: ... After 2 days incubating with 5 μM ROCK Inhibitor (Y-27632, RI, from Merck Millipore), 40 μM TGF-β inhibitor (SB 431524 ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM sodium ascorbate) on ice and filtered through 2 layers of Miracloth (Merck Millipore). Intact chloroplasts were collected from a band at the interface between the 40 % (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... which then were transferred into 4-5 fold bigger volume of cOmpleteTM Protease Inhibitor Cocktail (Roche, Merck) in PBS and gently mixed for 30 minutes to aid HA dilution ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 μl 0.2 μg/ml 4’,6’-diamidino-2-phenyl-indole (DAPI, Merck, catalog no. D9542) in PBS was added for 15 min at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed three times with DPBS for 5 minutes and incubated for 1 hour with respective secondary antibodies (Suppl. table 3) and DAPI (#10236276001; Merck Life Science, Dorset, UK) for nuclear counterstaining in 1% donkey serum ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were derivatized for 1 hour at 85 °C using N-tert-Butyldimethylsilyl-N-methyl-trifluroacetamide with 1% tert-Butyldimethylchlorosilane (Merck, NJ, USA) and immediately analysed by GC-MS ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...