Labshake search
Citations for Merck :
151 - 200 of 2267 citations for R 3 Amino 5 hexynoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... 4.7 μg/mL linoleic acid-oleic acid (Merck), 100 nM dexamethasone (Merck ...
-
bioRxiv - Biochemistry 2021Quote: ... -R-Bip (Merck), -Arg (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2020Quote: ... The resultant pellets were resuspended in 3% acetonitrile + 0.1% trifluoroacetic acid and peptide quantification performed using the Direct Detect system (Merck Millipore). Protein samples were normalized then vacuum concentrated in preparation for mass spectrometry.
-
bioRxiv - Molecular Biology 2020Quote: ... and plates were developed in n-hexane/diethylether/acetic acid 70:30:5 (v/v/v) (Merck, Roth) in a developing chamber (CAMAG ...
-
bioRxiv - Microbiology 2020Quote: ... primers 1022700 5F and R were used to amplify the 572 bp 5’ homology flank and primer pair 1022700 3F and R was used to amplify the 673 bp 3’ homology flank (KOD Hot Start DNA Polymerase, Merck Millipore) which were cloned on either side of the sfGFP expression cassette in pkiwi003 (Ashdown et al. ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... oleic acid and linoleic acid were obtained from Merck, all of them with a purity higher than 97%.
-
bioRxiv - Neuroscience 2021Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Neuroscience 2022Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Microbiology 2024Quote: ... polyethylene glycol was added to a final concentration of 5% (Cat # 25322-68-3, Merck), and a LFA strip (Cat # 3822-9000 ...
-
bioRxiv - Microbiology 2024Quote: ... Tris (Tris hydroxymethyl amino methane, pH 7.5, Merck®), modified MES buffer (25 mM MES (Sigma ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Cell Biology 2024Quote: ... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Genomics 2021Quote: ... and gentisic acid (2,5-dihydroxybenzoic acid; Merck, Product Number: 841745) was performed in AT minimal medium (86 ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested peptides were acidified by the addition of 5% (v/v) LC-MS grade Formid Acid (FA) (Merck, 5.33002.0050) and purified on C18 columns (Stagetips ...
-
bioRxiv - Microbiology 2020Quote: ... Formic acid (Merck) was added to end the reaction (5% v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Trichloroacetic acid(Merck), Fetal Bovine Serum (Merck ...
-
bioRxiv - Immunology 2023Quote: ... with Ehrlich’s reagent (Sigma)/perchloric acid (Merck) and absorbance was measured at 557 nm ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Microbiology 2021Quote: ... the pseudoparticles were added to the cells pre-incubated with inhibitors Bromhexine hydrochloride (Merck), Ambroxol hydrochloride (Merck) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Camptothecin (208925), rubitecan (9-nitrocamptothecin, R3655) and topotecan hydrochloride (T2705) were obtained from Merck Life Science.
-
bioRxiv - Neuroscience 2024Quote: ... Cytosine β-D-arabinofuranoside hydrochloride (Ara-C) (cat# C6645) (both from Merck, Auckland, NZ). BDNF (cat# RDS248BDB050) ...
-
bioRxiv - Cancer Biology 2024Quote: ... colonies from MDA-MB-468 cells were fixed by replacing the medium with a solution of 3% trichloroacetic acid in water (Merck, #T6399-500G), rinsed twice with water ...
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were stored at 4°C overnight before desilicification with 4% suprapure hydrofluoric acid (Merck; incubation of approximately 5 hours). Afterwards ...
-
bioRxiv - Biophysics 2024Quote: Glass coverslips (Paul Marienfeld GmbH, 24 x 50 mm, 170 ± 5 μm) were overnight incubated in 100 mM Sulphuric acid (Merck). Afterwards the coverslips were rinsed consecutively with Milli-Q water ...
-
bioRxiv - Microbiology 2021Quote: ... and SsuT3-oE-R (5′-AGTCAG GGATCC CTA CAC CAC CTT CAC TTT GGT ACC) with KOD Hot Start DNA polymerase (Merck Millipore) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Molecular Biology 2023Quote: ... Formic acid Ammonium formate and Perchloric acid were also purchased from Merck. Sodium dihydrogen phosphate and di-Sodium hydrogen phosphate were used to prepare the buffer for the enzymatic assay.
-
bioRxiv - Microbiology 2022Quote: ... citric acid (Merck, USA), lactic acid ...
-
bioRxiv - Biochemistry 2021Quote: ... Hydrochloric acid(Merck, India), Sodium dodecyl sulphate(Merck ...
-
bioRxiv - Biochemistry 2021Quote: ... Acetic acid(Merck, India), Methanol(Merck,India),-20°C Refrigerator ...
-
bioRxiv - Genomics 2021Quote: ... propionic acid (Merck, 8.00605.0500) (3 mL/L ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5M acetic acid (Merck) was added to reach 500 μL ...
-
bioRxiv - Neuroscience 2024Quote: ... oleic acid (W281506, Merck), linoleic acid (436305 ...
-
bioRxiv - Cancer Biology 2024Quote: ... periodic acid (Merck, 100524) was applied for 10 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... and naphthylphthalamic acid (Merck) were supplemented at concentrations indicated in the corresponding figures from 103 concentrated stocks dissolved in dimethylsulfoxide (Acros) ...
-
bioRxiv - Neuroscience 2024Quote: ... linoleic acid (436305, Merck) and α-linolenic acid (L2376 ...
-
bioRxiv - Bioengineering 2023Quote: ... tannic acid (403040, Merck); Iron chloride tetrahydrate (380024 ...
-
bioRxiv - Bioengineering 2023Quote: ... citric acid (Calbiochem, Merck), acetic acid (EMSURE ...
-
bioRxiv - Bioengineering 2023Quote: ... acetic acid (EMSURE, Merck), penicillin-streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2024Quote: ... and pantothenic acid (Merck). All incubations were carried out at 30°C.
-
bioRxiv - Genetics 2024Quote: ... tauroursodeoxycholic acid (TUDCA, Merck) or carbamazepine (CBZ ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...