Labshake search
Citations for Merck :
151 - 200 of 5021 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... BIO 1μM (cat n° B1686, Sigma-Aldrich Merck) and SB505124 50μM (cat n° S4696 ...
-
bioRxiv - Neuroscience 2024Quote: ... Dithiothreitol (DTT) and N-Ethylmaleimide (NEM) (Merck, UK) were dissolved in water to make a stock of 0.25 M ...
-
bioRxiv - Biophysics 2024Quote: ... After incubation solubilizing agents [0.04 N HCL (Merck) in isopropanol (Merck)] were added ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... pericarp sections were incubated for 2 h in a 5% (v/v) Normal Donkey serum (NDS; Merck) blocking solution in MTSB ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were labeled with 20 mM 5-chloro-2-deoxyuridine (CldU, Sigma-Aldrich by Merck, Darmstadt, Germany) for 20 min ...
-
bioRxiv - Microbiology 2022Quote: ... and protein expression was induced O/N with 0.5 mM isopropyl 1-thio ß-D-galactopyranoside (IPTG) (Merck Chemicals). The next day ...
-
bioRxiv - Biochemistry 2023Quote: ... coli pellet in 7.5 mL of TBS- N (Tris buffered saline with 0.1% NP-40) and supplemented with 1 x protease inhibitor cocktail tablet (Merck). Cells were sonicated for four rounds of one minute on ...
-
bioRxiv - Biophysics 2023Quote: ... Liposomes were labeled before experiments with 1% of 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (PE-Rhodamine) (Merck) at a concentration of 10µg/mL.
-
bioRxiv - Cell Biology 2024Quote: ... The obtained residue was derivatized with N-trimethylsilylimidazole/ trimethylchlorosilane reagent (TMSI:TMCS, 99:1, v/v; 50uL; both from Merck) and pyridine (50uL ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... or 1-octanol was used (1-OCT; CAS: 111-87-5; Merck, Darmstadt, Germany; undiluted). Paraffin is without behavioural significance in larval Drosophila (Saumweber et al ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% streptomycin and 2 mM of Glutamax and 0.1 μg·ml−1 GDNF (#SRP3200, Merck) (Vyas et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... pH 7.4 (Carl Roth),125 mM KCl (Merck),1 mM MgCl2 (Merck),1 mM EGTA/KOH pH 8.0 (Carl Roth),5% glycerol (Merck),1% NP-40 (Nonidet P 40 Substitute ...
-
bioRxiv - Genomics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Genetics 2021Quote: ... 90 µl 5 M NaCl and 1 µl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked for 1 h with 5% skim milk (Merck) in TBST [50 mM Tris-HCL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were blocked for 1 hour with 5% BSA (Merck, #A3294) in T-BST at room temperature and incubated with primary antibodies (ETV6::RUNX1 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 nM β-estradiol and 2 μg/mL insulin (Merck). Any red blood and unattached cells were removed by media change within 18 hours ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Merck) was added for nuclear staining and incubated at room temperature for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse anti-centrin-2 (1:500 IF; 20H5) from Merck, mouse anti-CEP152 (1:1000 WB and 1:2000 IF ...
-
bioRxiv - Cell Biology 2022Quote: ... medium was replaced with the culture medium containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL lipid extract was injected on a LiChroCART 250–4 LiChrospher® Si 60 (5 μm) (Merck) maintained at 25 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... and Click-iT® EdU (5-ethynyl-2’deoxyuridine) Assay (BCK-EDU488, baseclick GmbH, Merck/Sigma-Aldrich, UK), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck), respectively ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 μM of the protease inhibitor 4-(2-aminoethyl)-benzolsulfonyfluorid hydrochloride (BioChemica) and 5 U/mL-benzonase (Merck) were added (final concentrations) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:10,000 WB) and mouse monoclonal antibody recognizing the N-terminus β-Actin (#A5441, 1:10,000 WB) were purchased from Merck. Rabbit polyclonal phosphomyosin (Thr18/Ser19 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 U ml−1 penicillin and 50 μg ml−1 streptomycin (Merck Life Science (Sigma)) at 37 °C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by 5 min in a 1:1 mixture of propylene oxide (Fluka, Merck, Darmstadt, Germany) and SPURR (Low Viscosity Spurr Kit ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and SB505124 30μM (cat n° S4696, Sigma-Aldrich Merck). These molecules were dissolved in DMSO (cat n° D2438 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and SB505124 50μM (cat n° S4696, Sigma-Aldrich Merck). SB505124 drug was added to the filtered seawater at 3 hours post-fertilization stage ...
-
bioRxiv - Microbiology 2021Quote: ... Acetanilide (10.36 % N, 71.09 % C, Merck KGaA, Darmstadt, Germany) was used as the standard ...
-
bioRxiv - Plant Biology 2023Quote: ... transferred to Hybond N+ nitrocellulose membranes (Merck Millipore, USA), and cross-linked to membranes by UV radiation ...
-
bioRxiv - Microbiology 2023Quote: ... trimethoprim (TMP) and N-acetylglucosamine (GlcNAc) were from MERCK. Glutaraldehyde ...
-
bioRxiv - Neuroscience 2022Quote: ... n-amyl acetate (AM; CAS: 628-63-7, Merck) diluted 1:20 in paraffin oil (CAS ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... either n-amylacetate (AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Synthetic Biology 2024Quote: ... containing 20 μL N,O- Bis(Trimethylsilyl)acetamide (Merck) and incubated for four hours at 50 °C and then briefly vortexed before direct injection into an Agilent Technologies (Palo Alto ...
-
bioRxiv - Microbiology 2024Quote: ... diluted 1:100 in PBS with 1% BSA and 2% Triton™ X-100 (Merck Life Science UK Limited ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Immunology 2021Quote: ... supplemented with 2 % (vol/ vol) FCS and and 10 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, Merck) and cut into 1 cm pieces ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 nM 3,3′,5-Triiodo-L-thyronine sodium salt (Merck, cat. #T6397), and 1% penicillin-streptomycin (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... A solution of 5 g·L-1 bovine serum albumin (Merck-Sigma A9647) was used to construct a standard curve ...
-
bioRxiv - Cell Biology 2022Quote: ... the nuclei were visualized with Hoechst 33258 (Merck, B2883, 2 µg/ml in H2O at RT for 5 min).
-
bioRxiv - Microbiology 2022Quote: ... 5°6.7’ E) in September and October 2017 by filtering 2 L of seawater through PVDF membrane filters (Merck Millipore ...
-
bioRxiv - Biochemistry 2023Quote: ... The proteins were reduced utilizing a 5 mM solution of tris-2-carboxyethyl-phosphine (TCEP) (Merck KGaA, Darmstadt, Germany) at a temperature of 60 °C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... whose composition is as plating media but with 5% FBS and 2 μM cytosine β-d-arabinofuranoside (Merck, C6645) to limit glial growth ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...