Labshake search
Citations for Merck :
151 - 200 of 1953 citations for Ethyl 5 4 methoxyphenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... anti-fibrin (5 μg/ml, MABS2155, Merck), AlexaFluor488-conjugated anti-FXIIa (10 μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... supplemented with 5 μM Y-27632 (Merck). iPSCs used in the following experiments were between passages 15 and 21.
-
bioRxiv - Microbiology 2022Quote: ... 5 μm polycarbonate filter (TMTP14250; Merck Millipore), and 0.22 μm pore Sterivex cartridge (SVGP01050 ...
-
bioRxiv - Microbiology 2022Quote: ... 5 µm column (Merck KGaA, Darmstadt, Germany) at a column temperature of 40 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... EDTA 5 mM) supplemented with protease (Merck) and phosphatase inhibitor (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked with 5% milk (Merck) in PBS with 0.1% Tween 20 for 1 hour at room temperature and incubated in primary antibodies overnight at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml insulin (Merck, cat. # I6634), 5 µg/ml holo-transferrin (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ng/ml EGF (Merck, cat. #SRP3196), 50 nM dexamethasone (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... 5% glycerol) supplemented with Benzonase® (Merck) and cOmplete™ Mini EDTA-free protease inhibitor (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: The study used 5-MeO-DMT (Merck) dissolved in ultrapure water (18.2 MΩ.cm).
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM Potassium Ferrocyanide (Merck Life science) and 0.1% X-Gal (from a 4% X-Gal solution in dimethylformamide ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM Potassium Ferricyanide (Merck Life science), 5 mM Potassium Ferrocyanide (Merck Life science ...
-
bioRxiv - Bioengineering 2023Quote: ... 25% Glycerol (Merck-Millipore, #56-81-5), 0.1 M Tris (ITW Reagents ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5% β-mercaptoethanol (Merck; M6250). Subsequently ...
-
bioRxiv - Plant Biology 2024Quote: ... 5-hydroxyferulic acid (95%, Sigma-Aldrich Merck), sinapic acid (98% ...
-
bioRxiv - Biochemistry 2024Quote: ... and benzonase (5 U/mL, Merck Millipore). The cell lysates were harvested through scraping and transferred to 2-mL Eppendorf tubes ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mg of lysozyme (Merck; cat# 4403), and an EDTA-free protease inhibitor tablet (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... and 5% (v/v) sorbitol (Merck S1876) before CHT ceramic hydroxyapatite (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2024Quote: ... Tau (TAU-5) (Merck, catalog no. 577801), GAPDH (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by blocking with 5% BSA (Merck).
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked with 5% milk (Merck) in PBS with 0.1% Tween-20 for 1 hour at RT and subsequently incubated with anti-puromycin (1:2500 ...
-
bioRxiv - Biophysics 2024Quote: ... supplemented with 5% fetal bovine serum (Merck Life Science ...
-
bioRxiv - Cancer Biology 2024Quote: ... in 5 mM HCl (Merck, Darmstadt, Germany) at room temperature for 2 hours ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Molecular Biology 2021Quote: ... was centrifuged at 1500 rpm for 10 mins and the supernatant was used to measure inflammatory cytokines (IL-4, IL-5, IL-13, γ-INF) by LUMINEX multi-factor detection (MERCK). The cell pellets were fixed in 4% formaldehyde for Wright-Giemsa staining and total cells were counted and classified in each slide.
-
bioRxiv - Systems Biology 2020Quote: TGF-β/Activin/Nodal signal inhibitor (SB) stock (4–5 mM): SB 431542 hydrate (#S4317-5MG, Merck & Co., Inc., NJ, USA) diluted in DMSO (#D2650-5×5ML ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cancer Biology 2024Quote: ... After 30 minutes of incubation 100 μL of 2X STOP buffer (NaCl 340 mM, EDTA 20 mM, EGTA 4 mM, 5% Digitonin, 100 μg/mL RNase A (Merck, R6513), 50 μg/mL Glycogen (Thermo Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... Elution sample was concentrated at 3,300 rpm for 5 minutes per round until it reached 500 uL with Amicon Ultra-4 30K centrifugal filter system (Merck Millipore). Size exclusion chromatography was performed with Superdex200 increase 10/300 column (Cytiva ...
-
bioRxiv - Biochemistry 2022Quote: ... Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin, Bovine Serum, 12659, Merck Millipore) powder solved in 1 × TBST ...
-
bioRxiv - Developmental Biology 2021Quote: ... The HPLC was equipped with a hydrophilic ZIC-pHILIC column (150 × 2.1 mm, 5 μm) with a ZIC-pHILIC guard column (20 × 2.1 mm, 5 μm, Merck Sequant). 5ul of each sample was used for each assay ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Microbiology 2022Quote: ... were washed with RPMI 2%G by applying 5 psi perfusion for 5 min using the CellASIC® ONIX2 microfluidic system (version 1.0.4 Millipore Merck). Yeasts were loaded into the CellASIC culture chambers by applying 8 psi for 5 s twice (Thomson et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were incubated with Prussian’s blue solution containing ferrocyanide acid solutions (5% Hydrochloric acid (HCl) and 5% potassium ferrocyanide (Merck)) at a 1:1 ratio for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 ml conditioned medium was centrifuged (5 min, 500g) and filtered through Amicon Ultra-0.5 Centrifugal Filter unit (Merck). Ammonia in TIFs and SCFs was then quantified using Dimension Ammonia assay (Siemens ...
-
bioRxiv - Biochemistry 2023Quote: ... hexane and ethyl acetate were purchased from Merck (Darmstadt, Germany). Tween 20 ...
-
bioRxiv - Developmental Biology 2024Quote: ... the samples were transferred to ethyl cinnamate (ECi, 112372; Merck) for at least 6 hours before imaging ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Plant Biology 2024Quote: ... The extracts were spotted on a 5 cm x 5 cm TLC Silica gel 60 F₂₅₄ plate (Merck, Darmstadt, Germany). The blots were stained by spraying with a methanolic solution including 1% diphenylboric acid 2- aminoethylester (DPBA ...
-
bioRxiv - Genetics 2024Quote: ... 90%, 100% ethanol, 5 min each), cleared in xylene (twice, 5 min each) and mounted with DPX mounting medium (Merck).
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...