Labshake search
Citations for Merck :
151 - 200 of 1897 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... The LC separation was performed using the SeQuant Zic-pHilic (150 mm 3 2.1 mm) with the SeQuant guard column (20 mm 3 2.1 mm) (Merck). Mobile Phase B was acetonitrile ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein A and Protein G conjugated to HRP were purchased from Merck. DNA dye Hoechst 33342 was purchased from ThermoFisher Scientific and used at a final concentration of 5 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Thirty µl of Protein G (Protein G Sepharose Fast Flow, Merck, UK) slurry per sample was added in addition to 0.01% sodium azide and incubated on a roller overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... Total protein concentration was quantified by means of BCA protein assay (Merck). 10-20 μg of protein was separated by size using a 4-12% Bis-Tris Plus gel ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein A and Protein G conjugated to HRP were purchased from Merck. DNA dye Hoechst 33342 was purchased from ThermoFisher Scientific and used at a final concentration of 5 µg/ml.
-
bioRxiv - Cell Biology 2024Quote: ... Protein content was determined by performing a BCA protein assay (Merck Millipore). SDS-PAGE was performed on a Mini-PROTEAN System (BioRad ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Microbiology 2024Quote: ... and 3% Normal Goat Serum (Merck, S26)) for 1h at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mg/ml collagenase P (Merck), 1 mg/ml collagenase B (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3% Normal donkey serum (NDS, Merck), 2%BSA (NACALAI TESQUE) ...
-
bioRxiv - Neuroscience 2024Quote: ... and pyridine (Merck, Germany, 9:3:1) in a GC vial for GC–mass selective detector non-cholesterol and oxysterol analysis ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 µM IWR-1 (I0161, Merck) with 20 µM Y27632 ...
-
bioRxiv - Biochemistry 2020Quote: ... the medium was replaced with a serum-free media supplemented with 2 nM brain-derived neurotrophic factor (BDNF) (Merck Millipore). After 2 days in the BDNF-containing media ...
-
bioRxiv - Biophysics 2020Quote: ... the cells were incubated with a FCS-free media supplemented with 2 nM brain-derived neurotrophic factor (BDNF) (Merck Millipore). After 2 days ...
-
bioRxiv - Neuroscience 2021Quote: ... The cell medium was aspirated from the wells and fresh medium with one of the factors (Bafilomycin, 200 nM, Merck Millipore ...
-
bioRxiv - Cell Biology 2023Quote: HPAECs were seeded at the density of 10,000 cells/well in a pre-prepared 96-well plate containing 30μl of growth-factor reduced Matrigel (Merck, # CLS354230-1EA) per well (38) ...
-
bioRxiv - Neuroscience 2023Quote: ... Once DRGs were removed and placed in ice-cold neuronal growth medium (Neurobasal medium, B27, and 10 ng/ml Nerve growth factor (NGF)-2.5 s (Merck Millipore), 2 mM L-glutamine ...
-
bioRxiv - Genetics 2024Quote: ... The cells were first arrested at G1 using 2.5 µg mL-1 α-factor grown at 25°C (Cat. No. T6901, Merck). After 90 min ...
-
bioRxiv - Microbiology 2024Quote: ... removed and replaced with infection media −50:50 Ham’s F-12 Nutrient Mix and DMEM GLUAMax supplemented with 10 ng/ml Epidermal Growth Factor (Merck SRP3027), 5 µg/ml Insulin (Merck I2643) ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Biochemistry 2024Quote: ... and 3 μL (equivalent to 3 mg cell dry weight) were spotted on HPTLC silica gel 60 plates (Merck) and developed in chloroform/methanol/13 M NH3/1 M NH4Ac/water (180:140:9:9:23 ...
-
bioRxiv - Bioengineering 2022Quote: ... Protein concentrations were determined with the BCA protein assay kit (Novagen, Merck KGaA), and protein homogeneity was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Cancer Biology 2021Quote: Intracellular protein was extracted from cells using the NucBuster Protein Extraction Kit (Merck) and quantified using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... protein concentration was quantified using a Sigma-Aldrich BCA protein assay kit (Merck). Subsequently ...
-
bioRxiv - Biochemistry 2020Quote: ... Next the medium was replaced with a serum-free media supplemented with 2 nM brain-derived neurotrophic factor (BDNF) (Merck Millipore). After 2 days in the BDNF-containing media ...
-
bioRxiv - Molecular Biology 2021Quote: ... was centrifuged at 1500 rpm for 10 mins and the supernatant was used to measure inflammatory cytokines (IL-4, IL-5, IL-13, γ-INF) by LUMINEX multi-factor detection (MERCK). The cell pellets were fixed in 4% formaldehyde for Wright-Giemsa staining and total cells were counted and classified in each slide.
-
bioRxiv - Molecular Biology 2021Quote: TEER measurements [22] were performed on 3rd day of incubation with growth factors and (or) different inhibitors by using Millicell ERS-2 Electrical Resistance System (Merck-Millipore). Each insert was measured in three different locations ...
-
bioRxiv - Microbiology 2021Quote: ... Cytokine quantification was performed using a Human Cytokine/Chemokine/Growth Factor Panel A 48-Plex Premixed Magnetic Bead Multiplex Assay (Merck Millipore), using the Luminex MAGPIX System in 96-well plate format ...
-
bioRxiv - Developmental Biology 2023Quote: ... 80% of complete medium was changed to either new complete medium without trophic factors or complete medium containing 5 ng/mL BDNF (GF029 Merck Millipore) or 100 ng/mL human PGRN (AG-40A-0188Y Adipogen) ...
-
bioRxiv - Genetics 2024Quote: ... The cells were first arrested at G1 using 3.0 µg mL-1 α-factor at 30°C (Merck, Cat. No. T6901). After 90 min ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The embryos were then incubated with anti-cleaved caspase 3 pAb (1:100) (Anti-caspase-3, cleaved (Ab-2) Rabbit pAB (PC679; Merck) followed by a wash and a second incubation with anti-rabbit 568 ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Neuroscience 2024Quote: ACS was prepared from astrocyte cultures with aNSPC medium and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243 to obtain a < 3 kDa and a > 3 kDa fraction ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...