Labshake search
Citations for Merck :
151 - 200 of 4916 citations for 7 bromo 1 methyl 1 3 dihydro 2H benzo d imidazol 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... or rabbit anti-p34-Arc/ARPC2 (Arp2/3, 1:100, Merck, 07-227). This was followed by incubation with appropriate Alexa Fluor-conjugated secondary antibodies (1:500 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM DTT) and concentrated using a 3 kD MWCO centricon (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
Highly amine-reactive graphene-oxide EM grids for biochemical surface modification in aqueous bufferbioRxiv - Molecular Biology 2023Quote: ... 4-Amino-1-butanol (#178330) and 3- glycidoxypropyltrimethoxysilane (#440167) were obtained from Merck. Gold nanoparticle- PEG-amine conjugate was custom-synthesized by NanoPartz (Loveland CO ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... CDK9 was immunoprecipitated with 15μg of an anti-CDK9 antibody (D-7, sc-13130, lot no # B1422) or control mouse IgG (12-371, Merck) in IP Buffer with 2X SDS buffer (100mM NaCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 70% Epon/ethanol for 2h and overnight with pure Epon (Merck, Darmstadt, Germany). After fresh Epon for 4h ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were plated at 30,000 cells/well in 1/20 poly-D-lysine (Merck Milipore) precoated Costar Black (Corning ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were treated with 100 μM DRB (5,6-Dichlorobenzimidazole 1-β-D-ribofuranoside; Merck, D1916) or with 5 μg/ml α-amanitin (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... MDM were incubated with or without previously optimized concentrations of 1 µM cytochalasin D (Merck), 1 µM jasplakinolide (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... The plates and coverslips had been coated with 1 mg/mL poly-D-lysine (Merck) and 4 μg/mL laminin (Life Technologies).
-
bioRxiv - Plant Biology 2021Quote: ... and half-strength phosphatase inhibitor cocktail 2 and 3 (Merck). Samples were clarified twice by centrifugation at 14 000 g ...
-
bioRxiv - Cell Biology 2023Quote: ... in 2× saline sodium citrate (SSC; Merck, 6132-04-3)) for 5 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Mouse mAb anti-HA (clone HA-7) and mouse anti-tubulin (clone B5-1-12) were purchased from Merck. Mouse mAb anti-V5 (SV5-PK1 ...
-
bioRxiv - Neuroscience 2024Quote: ... SB431542 and LDN193189 were added until day 7 when cultures were supplemented with 1 μM smoothened agonist (SAG; Merck) and 0.5 μM purmorphamine (Pur ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were washed off the filter with an ice-cold freshly prepared mixture of methanol/ethanol/chloroform (1:3:1) (ethanol LiChroSolv©, Merck, Darmstadt ...
-
bioRxiv - Molecular Biology 2023Quote: ... exponentially growing RPE-1 cells were pulse-labeled with 1 μM CldU (5-Chloro-2’-deoxyuridine, Merck, C6891) and 250 μM IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 mM of MgCl2) with one protease inhibitor cocktail tablet (Mini EDTA-free, Roche, Merck) per 10 ml ...
-
bioRxiv - Neuroscience 2022Quote: ... The additive was prepared by dissolving D-Glucose-13C6 (389374, CAS 110187-42-3, Merck) as internal standard (IS ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mixture (2:1 v/v) of (PFA 4% (Merck, 104005) in PBS 1X pH7.4):OCT (Leica Surgipath ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (all Merck). The oxygen consumption rate (OCR ...
-
bioRxiv - Neuroscience 2020Quote: ... chicken anti-microtubule-associated protein 2 (MAP2; 1:2000; Chemicon/Merck), and guinea pig anti-vesicular glutamate transporter 1 (VGLUT1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Merck), mounted (Aqua Poly/Mount ...
-
bioRxiv - Neuroscience 2024Quote: ... combined with rabbit anti- MAP-2 (Merck Millipore, #AB5622, 1:800), followed by goat anti-mouse Dylight405 (Jackson ImmunoResearch ...
-
bioRxiv - Molecular Biology 2024Quote: ... and anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Molecular Biology 2022Quote: ... faecalis was diluted 1:100 into 3 L of Brain heart infusion (BHI, Merck) and grown at 37°C ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mM DTT) and concentrated using a 3 kDa MWCO Centriprep concentrators (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µL of benzonase (250,000 U/mL) (Merck, Fig. 2f and Extended Data Fig. 2c,d) or 1 µL of nuclease P1 (100,000 U/mL ...
-
bioRxiv - Microbiology 2023Quote: ... Each sample was suspended in M9 mineral medium supplemented with 0.5 mg.mL-1 D-glucose (Merck), 0.5% v/v of vitamin solution (DSMZ Medium 461 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rinsed with PBS and the proteins were visualized with Immobilon Western Chemiluminiscent HRP substrate (Merck/Millipore, used at 1:1:3 (H2O) dilution ...
-
bioRxiv - Biophysics 2022Quote: ... sucrose and methyl-β-cyclodextrin (mβCD) were obtained from Merck KGaA ...
-
bioRxiv - Developmental Biology 2023Quote: ... to which 10 µg/mL of methyl stearate (Merck, Singapore) was added as an internal standard ...
-
bioRxiv - Pathology 2023Quote: Cryosections of formalin-fixed lung tissue 7 μm thick were washed in PBS and permeabilized for 1 h with 0.01% Tween 20 (Sigma-Merck, Germany), followed by three washes in PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
bioRxiv - Microbiology 2021Quote: ... One mL of virus stock and 9 mL of MEM-E supplemented with 1% pyruvate (Merck KGaA, Darmstadt, Germany) were added to a conical tube with 16 × 106 SK-6 cells and shaken for 30 minutes at 104 rpm and 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 mL of a UPLC-grade water:methanol (3:1, v/v) solution with 1:500 diluted 13C-and 15N-labeled amino acids standard mix (Sigma-Aldrich, Merck, Darmstadt, Germany) was added to the tubes ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktail 2 (1:1000) (Merck Life Sciences U.K. Ltd). Cell debris was removed from lysates via centrifugation (275 × g ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 % (v/v) 2-mercaptoethanol) and 25 U/mL Benzonase (Merck #70746).
-
bioRxiv - Neuroscience 2021Quote: ... 350 µl of a 1:100 dilution of 2-Mercaptoethanol (Merck, 8057400250), 250 µl insulin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-oligodendrocyte transcription factor 2 (Olig2) (Merck-Millipore, 1:200), rabbit polyclonal anti-ionized calcium-binding adapter 1 (Iba-1 ...
-
bioRxiv - Pathology 2023Quote: ... 1 µl of 10x TCEP (Tris(2-carboxyethyl)phosphine hydrochloride (#C4706, Merck) was added to the lid and mixed carefully ...
-
Investigation of a Novel Mouse Model of Prader-Willi Syndrome with Invalidation of Necdin and Magel2bioRxiv - Systems Biology 2024Quote: ... mouse anti-neurophysin 2 clone PS38 (1:1000, Ref# MABN844, Merck Millipore), rabbit anti-GnRH (1:3,000 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... One pellet volume of ice-cold DPBS containing 3 mM MgCl2 was added followed by benzonase (Merck, #E1014-25KU) in a 1:1000 ratio ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified ShTnsC was concentrated to 1-2 mg mL−1 using 30,000 kDa molecular weight cut-off centrifugal filters (Merck Millipore) and flash-frozen in liquid nitrogen.
-
bioRxiv - Immunology 2022Quote: ... and spleen were harvested and homogenated in PBS for CFU counting or in isotonic buffer (Tris HCl 50 nM, EDTA 2 mM, PMSF 1 mM [Roche Diagnostics GmbH], Triton X-100 1% [Merck Life Science] ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified ShTnsC was concentrated to 1-2 mg mL−1 using 30,000 molecular weight cut-off centrifugal filters (Merck Millipore) and flash-frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit mAb Phospho-MAPK (Erk 1/2 Thr202/Tyr204) (D13.14.4E) (1:1,000; #4370; Cell Signaling Technology, mouse mAb GAPDH (1;5000, G8795, MERCK/Sigma-Aldrich).