Labshake search
Citations for Merck :
151 - 200 of 2937 citations for 6 Methyl 4 5 6 7 tetrahydrobenzo b thiophene 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6) or 1:200 anti-oxytocin receptor (polyclonal rabbit ...
-
bioRxiv - Evolutionary Biology 2019Quote: All experiments were carried out in casamino acids medium (CAA) containing 5 gl-1 casamino acids (Merck, Switzerland), 1.18 g l−1 K2HPO4*3H2O ...
-
bioRxiv - Physiology 2023Quote: ... Blots were washed 3 x for 7 min with TBS-T (200 mM Tris (Merck), 1.36 mM NaCl (Merck) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM sulphuric acid (H2SO4) (Titrisol, Merck, Germany) in water at 55 °C ...
-
bioRxiv - Physiology 2020Quote: ... and embedded in methyl methacrylate (MMA; Merck). The received block was additionally referenced for further control with the milling of three opposing grooves.
-
bioRxiv - Cell Biology 2023Quote: ... The blots were developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-brom-4-chlor-3-indoxylphosphate (BCIP; Merck, Darmstadt, Germany) for 5–30 min at RT ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells seeded in 6-well plates or 100mm dishes were transfected using GeneJuice (Merck) and 1 to 3µg DNA ...
-
bioRxiv - Plant Biology 2019Quote: ... leaf samples were harvested with a 6-mm-diameter cork borer (Z165220; Merck-Sigma-Aldrich), resulting in leaf discs with an area of 0.283 cm² ...
-
bioRxiv - Physiology 2022Quote: ... Food contained low melting agar (OmniPur® Agarose, Low Melting, CAS 9012-36-6, Merck) during lifespan assessments only to ensure the quality of compounds was preserved ...
-
bioRxiv - Microbiology 2022Quote: ... The sample was then injected into a Superose® 6 Increase 10/300 GL (Merck) column ...
-
bioRxiv - Neuroscience 2022Quote: ... Agarose 0.6% brain phantoms50 were prepared by dissolving agarose (A9539, CAS 9012-36-6, Merck) in tris-borate-EDTA buffer 1X (T4415 ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Microbiology 2023Quote: ... We used sterile-filtered 3 % bovine serum albumin (BSA heat shock fraction, pH 7, > 98 %, Merck) in 1 × Pierce PBS buffer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... at a final concentration of 5 μg/ml or Latrunculin B (428020-1MG, Merck) at a final concentration of 5 μM in M2 medium supplemented with dbcAMP ...
-
bioRxiv - Plant Biology 2021Quote: ... (+/-)-Abscisic acid (ABA, CAS No:14375-45-2), and Gibberellic acid (GA3, CAS No: 77-06-5) were purchased from Merck KGaA/ Sigma-Aldrich (Darmstadt ...
-
bioRxiv - Bioengineering 2022Quote: ... which was stopped through acidification with 5 μl of trifluoroacetic acid (Merck). Fifteen μg of each resulting peptide mixture were then desalted on Stage Tip (Rappsilber et.al. ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µl of each dilution were mixed with 10 µl of 0.4 mg ml-1 4-methyl-umbelliferyl-β-D- galactopyranoside (MUG) substrate (Merck, Darmstadt, Germany) that was prepared in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Physiology 2023Quote: ... and 6) enzymatic reaction to reveal peroxidase with Sigma Fast 3,3’-diaminobenzidine (Merck KGaA, Darmstadt, Germany) used as substrate ...
-
bioRxiv - Bioengineering 2023Quote: ... and 6 mg/ml 2000 kDa Fluorescein isothiocyanate–Dextran (FITC-Dextran; 46946, Merck, Kenilworth, NJ, USA) (4 ml/kg ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were tested every 6-12 months either by PCR (LookOut kit, Sigma/Merck) or Mycostrips (Invivogen ...
-
bioRxiv - Molecular Biology 2024Quote: 6 mL bone extraction buffer (1 M Trizma base, 0.1 M NaCl, 50 mM TitriplexIII (Merck), 0.5% SDS (Life Technologies ...
-
bioRxiv - Cancer Biology 2019Quote: ... 72 hrs or 7 days after adding the drugs organoids were fixed with 4% PFA (Merck) and stained with Hoechst (Invitrogen) ...
-
bioRxiv - Plant Biology 2023Quote: ... while 4-chloro-7-nitrobenzoxadiazole (NBD-Cl, 97%, Sigma-Aldrich, Merck Group, St Louis, MO, USA) was applied at 270LgLha−1 of active ingredient ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7 using repetitive washing and centrifugation with an Amicon 3 kDa MWCO centrifugal filter (Merck Millipore). For the synthesis of ditopic A’-A’ CC ligand ...
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Pathology 2023Quote: ... the slides were washed with acidified water (5 mL glacial acetic acid (Merck) in 11 mL distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
bioRxiv - Neuroscience 2019Quote: ... 0.92 mM phosphoric acid and 4% 2-propanol (all chemicals Merck KGaA, Darmstadt, Germany). Monoamines were detected using an electrochemical detector (41 000 ...
-
bioRxiv - Immunology 2022Quote: ... IL-6 and IL-1RA was performed using the Luminex color-coded antibody-immobilized beads from Merck Millipore following the manufacture’s indications ...
-
bioRxiv - Cell Biology 2022Quote: Stress assays (wounding or uraemic serum addition) were performed in Corning® 6-well plates (Merck, UK). The HDF ...
-
bioRxiv - Immunology 2022Quote: ... Transfections were carried out in 6 well plates with cells at 50–70% confluency using GeneJuice (Merck) with 1 μg of total plasmid DNA per well ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1/1000 dilution or Laurdan (#40227, 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine, Merck, Sigma-Aldrich) at 1/500 dilution for 30 min at 37°C in the dark ...
-
bioRxiv - Neuroscience 2023Quote: Trypsinise Ara-C purified SCs using 1 ml of 6% 2 mg ml-1 Trypsin (Merck - 85450C) in Versene (0.02% EDTA (Thermo Fisher - D/0700/53 ...
-
bioRxiv - Cancer Biology 2024Quote: ... we plated BC cells (3x105 cells in a 6 well-plate) embedded in collagen type ӏ (Merck) to mimic the breast ECM.
-
bioRxiv - Systems Biology 2020Quote: Wnt signal inhibitor (CK) stock (2.4–3 mM): CKI-7 dihydrochloride (#C0742-5MG, Merck & Co., Inc., NJ, USA) diluted in distilled water (Otsuka Pharmaceutical Factory ...
-
bioRxiv - Bioengineering 2019Quote: ... The supernatant was passed through the cartridges (pre-conditioned with 5 mL each of tert-methyl butyl ether, methanol (Merck; laboratory grade purity) and deionised water ...
-
bioRxiv - Physiology 2020Quote: ... at 4°C for 60 min using an Amicon Ultra-4 3 kDa centrifugal filter device (Merck Millipore). The 50 μL retentate was the final volume of concentrated EVs ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting peptides were extracted in 70% ethanol plus 5% formic acid (Merck-Millipore) twice for 20 min with permanent shaking ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated for 48 h with 3 μM 4-hydroxytamoxifen (Merck) and then kept in 300 nM until experimentation ...
-
bioRxiv - Plant Biology 2022Quote: ... a 70% ethanol solution containing 100 mM indole-3-acetic acid (IAA) (Merck KGaA, Darmstadt, Germany) was diluted 10,000 times in water to reach a final concentration of 10 μM IAA ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... in absolute ethanol (Thermo-Fischer; order code AJA214-2.5LPL) and 3 mL of propionic acid (Merck, Pty Ltd. ...