Labshake search
Citations for Merck :
151 - 200 of 4891 citations for 6 9 Methano 4 1 benzoxazepin 2 3H one octahydro 3 methyl 3 α 5a bta 6 bta 9 bta 9a bta 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... 14-3-3 binding was detected using anti-GST monoclonal antibody (Merck).
-
bioRxiv - Microbiology 2022Quote: ... and 4 μg/ml α-Glucosidase (Merck) and incubated at 37℃for 30 mins ...
-
bioRxiv - Plant Biology 2023Quote: ... and α-amylase (4 U/ml, Merck) in 200 mM sodium acetate– acetic acid ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the diet for both the transgenic and wild-type strains was supplemented with CuSO4•5H2O (1 mM, Merck, CAS-no: 7758-99-9). Flies were reared in a controlled environment room at 25.0 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... Rac1/3 (23A8, Merck), Rac2 [6] ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3% hydrogen peroxide (Merck) was applied to the sections prior to incubation with HRP-conjugated secondary antibodies for 1h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 µM TBTA (Merck), 3 µM Picolyl-Alexa647-Azide (Jena Bioscience ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Biophysics 2020Quote: ... Then His-tag containing OpuAC was introduced to the flow cell (in buffer B supplemented with 10 mM of (±)6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox; Merck) as a photostabilizer[20] ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Immunology 2021Quote: ... and washed by ultracentrifugation at 4°C using a 3 kDa filter (UFC900324, Merck-Millipore) to remove imidazole ...
-
bioRxiv - Developmental Biology 2023Quote: ... and left overnight at 4°C in blocking solution containing 3% Donkey Serum (D9663, Merck) and 0.03% Sodium Azide (40-2000-01 ...
-
bioRxiv - Cell Biology 2019Quote: Pooled extracts of additional control pancreas (n=6) and plasma (n=6) of the experimental groups were filtered with a 30 kDa cut-off Microcon filter (Merck Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay was used to analyze the cell viability of SH-SY5Y cells ...
-
bioRxiv - Microbiology 2023Quote: ... 2–3 mL of stock solution was applied onto preparative TLC plates (glass, Merck, 20×20 cm ...
-
bioRxiv - Bioengineering 2023Quote: ... 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Merck (Germany). The U-87 cell line was a kind gift from Esendagli Group at Hacettepe University (Turkey) ...
-
bioRxiv - Genomics 2021Quote: ... rosea strains was inoculated at edge of a 9-cm-diameter potato dextrose agar (PDA; Merck, Kenilworth, NJ) Petri plate covered with a durapore membrane filter (Merck ...
-
bioRxiv - Physiology 2022Quote: ... The water contained in the expired gas was trapped using silica gel beads (Merck, CAS #: 7631-86-9). A portable oxygen analyzer (PO2-250 ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfections for the generation of stable cell lines were performed using X-tremeGENETM 9 DNA transfection reagent (Merck), following the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6), anti-GFAP (goat polyclonal ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.3 U hexokinase (Scientific Laboratory Supplies) and 1 U glucose-6-phosphase dehydrogenase (Merck) in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6) or 1:200 anti-oxytocin receptor (polyclonal rabbit ...
-
bioRxiv - Cancer Biology 2020Quote: ... as were CK5/6 (clone D5/16B4; Merck) and p63 (clone 7JUL ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of chloroform:isopropanol 2:1 (v:v)(Merck) were used to elute the neutral lipid fraction (NL) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Developmental Biology 2022Quote: ... MII oocytes were activated for 6 h in Ca-free α-MEM medium containing 10 mM SrCl2 and 5 μM Latrunculin B (cat. no. 428020, Merck Millipore, Darmstadt, Germany). Following activation ...
-
bioRxiv - Bioengineering 2021Quote: Three sender area squares (3 × 3 mm) were put into a 24-well containing 300 μL of anti-His antibody (Merck, Germany, NOVG70796-3) (10 μg mL−1 in DPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Molecular Biology 2019Quote: Inflorescences were harvested into fresh fixative (3:1 96% ethanol (Merck) and glacial acetic acid ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... 3’-diaminobenzidine (DAB; Merck, Germany). DAB polymerizes in contact with H2O2 in the presence of peroxidase ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 (mouse monoclonal from Merck), GABA A Receptor γ (guinea pig polyclonal from SYSY) ...
-
bioRxiv - Microbiology 2022Quote: ... 3 gr/L (Merck, Germany); Na2HPO4 ...
-
bioRxiv - Microbiology 2020Quote: ... SU5402 3 μM (SML0443; Merck); and DAPT 10 μM (D5942 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM MgCl2 (#105833, Merck), 2 mM EGTA (Triplex®VI #108435 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Immunology 2023Quote: ... and 3% H2O2 (Merck, 216763). Fresh bleaching solutions were prepared and slides were bleached two times (15 min each ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3% H2O2 (Merck – 216763). Fresh bleaching solutions were prepared ...
-
bioRxiv - Immunology 2023Quote: ... BAM-15 (3 μM; Merck), rotenone (2 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM ATP (Merck, A2383), 2 mM GTP (Jena Bioscience ...
-
bioRxiv - Immunology 2023Quote: ... and 3% H2O2 (Merck, #216763,) for 3 rounds (15 mins each ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM Chiron (Merck #SML1046), 1 μM PD 0325901 (Merck #PZ0162) ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 kDa MWCO (Merck - UFC500324) and 0.5 µl were injected to LC-MS system ...