Labshake search
Citations for Merck :
151 - 200 of 5258 citations for 4 Bromo 3' 1 3 dioxolan 2 yl 2 fluorobenzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Ovaries were washed again and incubated in DAPI (4’,6-diamidino-2-phenylindole 1 μg/mL, Merck) for 5 min at room temperature.
-
bioRxiv - Immunology 2021Quote: ... and washed by ultracentrifugation at 4°C using a 3 kDa filter (UFC900324, Merck-Millipore) to remove imidazole ...
-
bioRxiv - Developmental Biology 2024Quote: ... and left overnight at 4°C in blocking solution containing 3% Donkey Serum (D9663, Merck) and 0.03% Sodium Azide (40-2000-01 ...
-
bioRxiv - Biophysics 2024Quote: ... 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck KGaA (Darmstadt ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3T3-J2 fibroblasts were treated for 3 hours with 4 μg/mL mitomycin C (Merck) at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to adding the cells.
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Bioengineering 2021Quote: Three sender area squares (3 × 3 mm) were put into a 24-well containing 300 μL of anti-His antibody (Merck, Germany, NOVG70796-3) (10 μg mL−1 in DPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated for 10 minutes in 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000, Merck, Italy, D9542), to allow visualization of cell nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µM Carbonyl cyanide 3-chlorophenylhydrazone (CCCP; Merck, Cat. #C2759, Germany), 1 µM rotenone (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Microbiology 2021Quote: ... 3’-diaminobenzidine (DAB; Merck, Germany). DAB polymerizes in contact with H2O2 in the presence of peroxidase ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 (mouse monoclonal from Merck), GABA A Receptor γ (guinea pig polyclonal from SYSY) ...
-
bioRxiv - Microbiology 2022Quote: ... 3 gr/L (Merck, Germany); Na2HPO4 ...
-
bioRxiv - Microbiology 2020Quote: ... SU5402 3 μM (SML0443; Merck); and DAPT 10 μM (D5942 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM MgCl2 (#105833, Merck), 2 mM EGTA (Triplex®VI #108435 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 kDa MWCO (Merck - UFC500324) and 0.5 µl were injected to LC-MS system ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM Chiron (Merck #SML1046), 1 μM PD 0325901 (Merck #PZ0162) ...
-
bioRxiv - Immunology 2023Quote: ... and 3% H2O2 (Merck, 216763). Fresh bleaching solutions were prepared and slides were bleached two times (15 min each ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3% H2O2 (Merck – 216763). Fresh bleaching solutions were prepared ...
-
bioRxiv - Immunology 2023Quote: ... BAM-15 (3 μM; Merck), rotenone (2 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM ATP (Merck, A2383), 2 mM GTP (Jena Bioscience ...
-
bioRxiv - Immunology 2024Quote: ... and 3% H2O2 (Merck, #216763,) for 3 rounds (15 mins each ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 mM MgCl2 (Merck, #7791186), 0.3% (vol/vol ...
-
bioRxiv - Neuroscience 2021Quote: ... Microtubule-Associated Protein 2 (MAP-2) (Merck Millipore Burlington ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% glucose + 2% D/L-lactate (Merck), or 2% D/L-lactate alone [31].
-
bioRxiv - Cell Biology 2021Quote: The vessel lumen was washed 3 times with PBS ++ (PBS with 1mM CaCl2, 0.5mM MgCl2) and fixed with 4% paraformaldehyde (PFA, Merck, #30525-89-4) at 37°C for 15 min ...
-
bioRxiv - Systems Biology 2023Quote: ... after adding 1 mL of chloroform:methanol 2:1 (v:v) (Merck), the sample was vortexed at 1200 rpm for 1 h at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... Grids were then stained with 2% (w/v) uranyl acetate pH 4 (Merck) for 1 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... The nuclei were stained with 4′,6-diamidin-2-phenylindol (DAPI, Merck, Germany).
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Neuroscience 2024Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (D9542) (all from Merck, Auckland, NZ). See table S2 for antibodies used for immunocytochemistry (ICC).
-
bioRxiv - Microbiology 2024Quote: ... was obtained by using 4’,6-di-amidino-2-phenyl-indole (DAPI; Merck KGaA - Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% penicillin-streptomycin and 0.00035% 2-mercaptoethanol (Merck)) to an orbital shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of 1 M DTT (Merck, D9779) was added and the sample was heated for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... the MEK1/2 inhibitor PD0325901 (1 μM, Merck), LDN-193189 (100 nM ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Plant Biology 2021Quote: Arabidopsis 14-3-3 isoforms Epsilon and Lambda were expressed using the pGEX-4T1 vector (Merck), as a translational fusion with glutathione-S-transferase (GST ...