Labshake search
Citations for Merck :
151 - 200 of 5257 citations for 4 1 1 2 3 3 3 Hexafluoropropoxy acetophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Plant Biology 2020Quote: Inflorescences were harvested into fresh fixative (3:1 96% [v/v] ethanol [Merck] and glacial acetic acid) and kept overnight (O/N ...
-
bioRxiv - Biochemistry 2022Quote: ... and concentrated to 13.7 mg·ml-1 (A280=23.36) using a centrifugal filter (Amicon Ultra-0.5, MWCO 3 kDa, Merck Millipore) prior to crystallization ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 % (w/v) Bovine serum albumin and 3 % (v/v) goat serum (Merck Life Science cat. G9023). Following blocking ...
-
bioRxiv - Immunology 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... Traps deployed by BCC were also baited with 1-octen-3-ol (Merck Life Science, Bayswater, Australia) (van Essen et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APTS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with rabbit-α-pH3Ser10 (1:250 for 3 hours at room temperature; Merck Millipore, Burlington, MA), incubated with goat-α-rabbit-AF568 (1:250 for 45 minutes at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Plant Biology 2024Quote: ... protoplasts were treated with 3 µM DAPI (Merck) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... 3 rounds of phenol-chloroform-isoamyl alcohol (Merck) extraction were performed using 15 ml gel-lock tubes (QIAGEN) ...
-
bioRxiv - Molecular Biology 2022Quote: ... rinsed with PBS and the proteins were visualized with Immobilon Western Chemiluminiscent HRP substrate (Merck/Millipore, used at 1:1:3 (H2O) dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein solution was centrifuged at 16,000 g for 30 minutes with a 3 kD cut-off filter (Amicon Ultra Centrifugal Filter, 3 kDa MWCO, Merck Millipore) to remove previous buffer ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of N,N,N’,N’-Tetramethylethylendiamine (TEMED, #612-103-00-3, Sigma-Aldrich now Merck) was added to 1 ml of the monomer solution ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...
-
bioRxiv - Biochemistry 2020Quote: TSEN complexes were mixed to a final concentration of 1 or 3 μM with 4x SYPRO Orange (Merck) stock in 50 mM HEPES-NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... Fibers were washed 3×10 min in PBS and incubated in blocking buffer (1% bovine serum albumin (Merck), 5% goat serum (16210-064 ...
-
bioRxiv - Molecular Biology 2024Quote: ... air-dried at RT for 30 min and fixed in Methanol:Acetic acid in a 3:1 ratio (Merck) at 4°C overnight ...
-
bioRxiv - Physiology 2024Quote: ... 5 min incubation at room temperature with 100 µL 1-Bromo-3-chloropropane (BCP) (Merck, Darmstadt, Germany, #B9673) was performed ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 mL of a UPLC-grade water:methanol (3:1, v/v) solution with 1:500 diluted 13C-and 15N-labeled amino acids standard mix (Sigma-Aldrich, Merck, Darmstadt, Germany) was added to the tubes ...
-
bioRxiv - Neuroscience 2021Quote: ... and Pellet Paint Co-precipitant (Merck Millipore #69049-3). Genomic DNA traces were removed with DNA-free DNase Treatment and Removal Reagents (FisherScientific #AM1906 ...
-
bioRxiv - Biochemistry 2020Quote: ... using 3 kDa MWCO Amicon centrifugal filters (Merck Millipore). For protein denaturation ...
-
bioRxiv - Molecular Biology 2023Quote: ... the anti-S tag antibody (Merck, Cat# 71549-3) was added directly to the medium of each well resulting in a final dilution of 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated with Benzonase Nuclease (Merck Millipore, US170664-3) for 30 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 3-HA were purchased from Merck (Sigma-Aldrich). For L-kynurenine and kynurenic acid ...
-
bioRxiv - Genomics 2022Quote: ... and subsequently blocked in 3% BSA (A8022, Sigma/Merck) in 1x PBS-Tween (137 mM NaCl ...
-
bioRxiv - Plant Biology 2023Quote: ... using a 3 kDa MWCO Amicon centrifugal concentrator (Merck) and the N-terminal His6-tag cleaved with Human Rhinovirus 3C protease at 4°C overnight ...