Labshake search
Citations for Merck :
151 - 200 of 4240 citations for 3 Cyclohex 1 enyl acrylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and pantothenic acid (Merck). All incubations were carried out at 30°C.
-
bioRxiv - Genetics 2024Quote: ... tauroursodeoxycholic acid (TUDCA, Merck) or carbamazepine (CBZ ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Tryptic peptides were acidified to a final concentration of 1% formic acid (FA) (Merck), cleaned up using SepPak cartridges (Waters) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilizing the beads on the magnetic rack ...
-
bioRxiv - Developmental Biology 2023Quote: ... We used Hoyer’s mounting medium in a1:1 proportion with lactic acid (90% MERCK) to preserve the cuticle of the legs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilizing the beads on the magnetic rack ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilising the beads on the magnetic rack ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilizing the beads on the magnetic rack ...
-
bioRxiv - Developmental Biology 2024Quote: ... 50 μg ml−1 L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Merck A8960), 20 ng ml−1 heregulin beta-1 (Thermo Fisher 100-03-50UG) ...
-
bioRxiv - Biochemistry 2022Quote: ... Reversible blockage of cysteines was performed with S-methyl methanethiosulfonate (MMTS, Merck, Sigma-Aldrich, 64306-1ML) at 4 mM for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µM Carbonyl cyanide 3-chlorophenylhydrazone (CCCP; Merck, Cat. #C2759, Germany), 1 µM rotenone (Merck ...
-
bioRxiv - Biochemistry 2024Quote: ... HPLC-grade trichloroacetic acid (TCA) and difluoroacetic acid (DFA) were purchased from Merck and Sigma-Aldrich (Munich ...
-
bioRxiv - Molecular Biology 2024Quote: ... The embryos were then incubated with anti-cleaved caspase 3 pAb (1:100) (Anti-caspase-3, cleaved (Ab-2) Rabbit pAB (PC679; Merck) followed by a wash and a second incubation with anti-rabbit 568 ...
-
bioRxiv - Microbiology 2020Quote: ... and finally through a 0.22 μm collection filter (Cellulose mixed ester membrane filter; Merck Millipore, USA). The pre-processed samples were then kept in 2 ml microcentrifuge tubes ...
-
bioRxiv - Microbiology 2022Quote: ... followed by filtration through a MF-Millipore 8 µm sterile mixed cellulose ester (MCE) membrane (Merck Millipore Ltd. ...
-
bioRxiv - Biochemistry 2023Quote: ... 40 μg of protein was added to each well and run in Boric acid-Tris buffer (192 mM Boric acid, Merck; 1 mM EDTA, Merck; 0.1% SDS, to pH 7.6 with Tris) at 25 mA for 1.5 h ...
-
bioRxiv - Cell Biology 2024Quote: ... and counterstained with Fast Green (0.04% w/v in 1% acetic acid, Merck, Darmstadt, Germany).
-
bioRxiv - Cancer Biology 2024Quote: ... The reaction was stopped with the addition of 1% formic acid (Merck, 64-18-6) and peptides were dried in a SpeedVac ...
-
bioRxiv - Molecular Biology 2024Quote: ... HCT-8 cells were seeded at 2 x 10⁵ in 24-well plates and treated with the appropriate metabolites (cis-4,7,10,13,16,19-docosahexaenoic acid, creatine, 1-methylnicotinamide – all Merck). All metabolites used in this study were prepared by dissolving in water ...
-
bioRxiv - Genetics 2022Quote: ... or SD complete amino acid agar (0.67% yeast nitrogen base with amino acids (Merck), 2% glucose ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... To deplete Xrn1 and Dcp2 with the AID tags (Nishimura et al., 2009; Morawska and Ulrich, 2013) 1-Naphthaleneacetic acid (1-NAA; N0640-25G, Merck) was added to a final concentration of 1 mM ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-phosphorylated (Ser897)-N-methyl-D-aspartate receptor (anti phosphoNMDAR cat.#ABN99, Merck Millipore, Burlington, MA, USA), anti-total-calcium/calmodulin-dependent protein kinase II (anti-tCaMK ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Birds from the anxiogenic group received 2.5 mg/kg of β-CCM (β-carboline-3-carboxylic acid-N-methylamide [FG 7142], Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) dissolved in DSMO (Dimethyl Sulfoxide suitable for HPLC ...
-
bioRxiv - Physiology 2022Quote: ... Phosphomolybdic Acid Orange G (Merck AG ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.01% pluronic acid (Merck) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 14% acetic acid (Merck). Plates were washed in water ...
-
bioRxiv - Microbiology 2020Quote: ... propionic acid (Merck, Darmstadt, Germany), n-valeric acid (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Pure oxalic acid (Merck, Germany) was identified by the retention time and was quantified by an external standard curve ...
-
bioRxiv - Microbiology 2022Quote: ... L-lactic acid (~90%, Merck), ethanol and glycerol were added to final concentrations of 40 mM ...
-
bioRxiv - Physiology 2022Quote: ... water and formic acid (Merck) in different proportions ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% Trifluoroacetic acid (TFA, Merck), 1 M glycolic acid (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... and L-ascorbic acid (Merck) supplemented with FGF2 (4 ug/mL ...
-
bioRxiv - Immunology 2023Quote: ... and concentrated sulfuric acid (Merck) for at least 30 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Linolenic acid (L2376-500MG, Merck), L-Carnitine hydrochloride (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 150 µM ascorbic acid (Merck), 55 µM β-mercaptoethanol (Thermo Fisher) ...
-
bioRxiv - Genetics 2023Quote: ... folic acid (FA, Merck, #F8758) and 5-methyltetrahydrofolate (5-MTHF ...
-
bioRxiv - Physiology 2024Quote: ... in picric acid (80456, Merck) for 2 hours.
-
bioRxiv - Biochemistry 2024Quote: ... sulfuric acid (H2SO4, Merck, 97%), potassium dichromate (K2Cr2O7 ...
-
bioRxiv - Synthetic Biology 2024Quote: Stearic acid (C18:0, Merck)
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 mM ascorbic acid (Merck), 0.84 uM biotin (Merck) ...
-
bioRxiv - Biochemistry 2024Quote: ... fatty acid-free (Merck, 10775835001) was substituted for regular (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 20μM Retinoic Acid (Merck). At day 6 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Plant Biology 2023Quote: ... Acid digestion was performed by adding 9 mL of 69% nitric acid (HNO3) (Suprapur, Merck) and 1 mL of 30% hydrogen peroxide (H2O2 ...