Labshake search
Citations for Merck :
151 - 200 of 4630 citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Microbiology 2024Quote: ... and 3% Normal Goat Serum (Merck, S26)) for 1h at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mg/ml collagenase P (Merck), 1 mg/ml collagenase B (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3% Normal donkey serum (NDS, Merck), 2%BSA (NACALAI TESQUE) ...
-
bioRxiv - Bioengineering 2021Quote: The rat INS-1 832/3 cell line (insulinoma cell line stably transfected with human insulin; hereinafter INS-1) was obtained from Merck. A HUVEC (human umbilical vein endothelial cell ...
-
bioRxiv - Immunology 2024Quote: ... 2010) that recognizes a common epitope on MASP-1,-3 and MAP-1 followed by HRP-conjugated streptavidin (Merck, RPN1231). The plates were revealed using TMB One as the substrate (Kementec ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Immunology 2021Quote: ... Enriched HSPC-pDCs were then primed for 1-3 days in RF10 (RPMI-1640 medium (Merck) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... Acetylated histone 3 was detected using a polyclonal rabbit antibody (Merck, 06-599, 3260200, 1:500) and visualized using a donkey anti-rabbit Alexa Fluor 488 secondary antibody (Molecular Probes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng G-CASE and 3 mL PEI solution (1 mg/mL) (Merck KGaA, Darmstadt, Germany). 100 µL transfected cells were seeded per well onto 96-well plates (Brand ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM DTT) using Amicon Ultra-15 3 K or 30 K centrifugation units (Merck Millipore). The phase separation assay was performed in the presence or absence of 10% polyethylene glycol 8000 (PEG-8000 ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 μL (equivalent to 3 mg cell dry weight) were spotted on HPTLC silica gel 60 plates (Merck) and developed in chloroform/methanol/13 M NH3/1 M NH4Ac/water (180:140:9:9:23 ...
-
bioRxiv - Cell Biology 2020Quote: ... All surrounding agarose was removed from the tissue and 2-3 tissue slices were positioned on each Millicell Cell Culture Insert (Merck Millipore, PICM0RG50) using No.22 scalpels (Swann-Morton ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 2 x 10 min in 100% ethanol) and subsequently incubated for 3 min in HMDS (Hexam-ethyldisilazane, Merck, Gillingham, UK) before quickly air drying the samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Immunology 2022Quote: ... type 2 and type 3 were mixed and subsequently concentrated using 10 kDa Amicon® Ultra Centrifugal Filters (Merck Millipore, Billerica, MA) to a nominal concentration of 10000-16000-32000 DU/mL.
-
bioRxiv - Molecular Biology 2024Quote: ... and 6 mM 2-mercaptoethanol] and then vortexed with an approximately equal volume of glass beads (212–300 mm) for 3 minutes (Merck KGaA, Germany). The homogenate was centrifuged at 12,000 g for 8 min at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were washed off the filter with an ice-cold freshly prepared mixture of methanol/ethanol/chloroform (1:3:1) (ethanol LiChroSolv©, Merck, Darmstadt ...
-
bioRxiv - Bioengineering 2024Quote: ... 1% (v/v) dimethyl sulfoxide (D2650, Merck), 0.1 mM 2-mercaptoethanol (198-15781 ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Neuroscience 2024Quote: ACS was prepared from astrocyte cultures with aNSPC medium and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243 to obtain a < 3 kDa and a > 3 kDa fraction ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Plant Biology 2020Quote: Inflorescences were harvested into fresh fixative (3:1 96% [v/v] ethanol [Merck] and glacial acetic acid) and kept overnight (O/N ...
-
bioRxiv - Biochemistry 2022Quote: ... and concentrated to 13.7 mg·ml-1 (A280=23.36) using a centrifugal filter (Amicon Ultra-0.5, MWCO 3 kDa, Merck Millipore) prior to crystallization ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 % (w/v) Bovine serum albumin and 3 % (v/v) goat serum (Merck Life Science cat. G9023). Following blocking ...
-
bioRxiv - Immunology 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Bioengineering 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APTS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with rabbit-α-pH3Ser10 (1:250 for 3 hours at room temperature; Merck Millipore, Burlington, MA), incubated with goat-α-rabbit-AF568 (1:250 for 45 minutes at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...