Labshake search
Citations for Merck :
151 - 200 of 2661 citations for 2' 3' Dimethyl 3 2 5 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) to stop the fixation reaction.
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) and subsequently allowed to adhere on ICAM-1 coated glass slides before TOCCSL imaging ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck)) ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck). Cells were kept on ice or seeded onto ICAM-1-coated glass slides for imaging at 37°C and in TIRF mode ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) and afterwards incubated with excess amounts of mSav-cc-PS-CFP2 for 30 minutes on ice ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) and subsequently allowed to adhere on ICAM-1 coated glass slides prior to imaging in TIRF mode at 22.5°C ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck)) ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck)) and kept on ice until imaging proceeded ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck)) prior to imaging.
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck). Cells were allowed to adhere on ICAM-1 coated glass slides for 10 minutes at 25°C before fixation ...
-
bioRxiv - Immunology 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to seeding the cells onto ICAM-1-coated glass-slides ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1x phosphatase inhibitor 3 (Merck). Cell debris was removed by pelleting at 5000g for 10mins ...
-
bioRxiv - Immunology 2021Quote: ... 3-Methyladenine (3MA, 5mM; Merck Millipore) or Anakinra (500ng/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-mGluR2/3 (Merck Millipore), rabbit anti-CRTAC1 (Merck Millipore) ...
-
bioRxiv - Neuroscience 2022Quote: ... primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... - 3% horse serum (Merck, ref H1270) PBS solution for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 units/ ml nystatin (Merck: N1638) and 20 mM HEPES ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3% bovine serum albumin (Merck). The azide-alkyne reaction was performed using the Click-iT™ Cell Reaction Buffer Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... nystatin (3 units/ml) (Merck: N1638) and ascorbic acid (500 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (Merck; UK 28718-90-3) was included as a final wash stage ...
-
bioRxiv - Developmental Biology 2024Quote: ... or 3% Rabbit Serum (R9133, Merck)) and finally applying the conjugated antibody ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Cell Biology 2023Quote: ... the reducing agent 2 µl 2-picoline borane complex (PB, 2 M in DMSO, Merck) and 2 µl water ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Genomics 2023Quote: ... then immersed in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... dimethyl sulfoxide (DMSO, Merck, 99.9%), phosphate buffered solution standard tablets (PBS ...
-
bioRxiv - Biophysics 2023Quote: ... 2-aminoethoxydiphenyl borate (2-APB) (Sigma-Aldrich/Merck, Germany), BL-1249 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (all Merck). The pH was adjusted to 7.3-7.4 (S20 ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Physiology 2024Quote: ... 5 min incubation at room temperature with 100 µL 1-Bromo-3-chloropropane (BCP) (Merck, Darmstadt, Germany, #B9673) was performed ...
-
bioRxiv - Genetics 2024Quote: ... The LC separation was performed using the SeQuant Zic-pHilic (150 mm 3 2.1 mm) with the SeQuant guard column (20 mm 3 2.1 mm) (Merck). Mobile Phase B was acetonitrile ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal anti-α-tubulin clone B-5-1-2 (Merck T5168; 1:5000), mouse monoclonal anti-EF-18 clone A-5 (Santa Cruz Biotechnology sc-393731 ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...