Labshake search
Citations for Merck :
151 - 200 of 4934 citations for 1 Piperidin 4 yl azetidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... and naphthylphthalamic acid (Merck) were supplemented at concentrations indicated in the corresponding figures from 103 concentrated stocks dissolved in dimethylsulfoxide (Acros) ...
-
bioRxiv - Neuroscience 2024Quote: ... oleic acid (W281506, Merck), linoleic acid (436305 ...
-
bioRxiv - Neuroscience 2024Quote: ... linoleic acid (436305, Merck) and α-linolenic acid (L2376 ...
-
bioRxiv - Bioengineering 2023Quote: ... tannic acid (403040, Merck); Iron chloride tetrahydrate (380024 ...
-
bioRxiv - Bioengineering 2023Quote: ... citric acid (Calbiochem, Merck), acetic acid (EMSURE ...
-
bioRxiv - Bioengineering 2023Quote: ... acetic acid (EMSURE, Merck), penicillin-streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2024Quote: ... and pantothenic acid (Merck). All incubations were carried out at 30°C.
-
bioRxiv - Genetics 2024Quote: ... tauroursodeoxycholic acid (TUDCA, Merck) or carbamazepine (CBZ ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Tryptic peptides were acidified to a final concentration of 1% formic acid (FA) (Merck), cleaned up using SepPak cartridges (Waters) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilizing the beads on the magnetic rack ...
-
bioRxiv - Developmental Biology 2023Quote: ... We used Hoyer’s mounting medium in a1:1 proportion with lactic acid (90% MERCK) to preserve the cuticle of the legs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilizing the beads on the magnetic rack ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilising the beads on the magnetic rack ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were acidified to a final concentration of 1% Trifluoroacetic acid (Uvasol; MERCK KgaA) prior to immobilizing the beads on the magnetic rack ...
-
bioRxiv - Developmental Biology 2024Quote: ... 50 μg ml−1 L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Merck A8960), 20 ng ml−1 heregulin beta-1 (Thermo Fisher 100-03-50UG) ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µM Carbonyl cyanide 3-chlorophenylhydrazone (CCCP; Merck, Cat. #C2759, Germany), 1 µM rotenone (Merck ...
-
bioRxiv - Biochemistry 2024Quote: ... HPLC-grade trichloroacetic acid (TCA) and difluoroacetic acid (DFA) were purchased from Merck and Sigma-Aldrich (Munich ...
-
bioRxiv - Molecular Biology 2024Quote: ... The embryos were then incubated with anti-cleaved caspase 3 pAb (1:100) (Anti-caspase-3, cleaved (Ab-2) Rabbit pAB (PC679; Merck) followed by a wash and a second incubation with anti-rabbit 568 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 % Triton-X and 1x BugBuster (Merck Millipore, #70584-4) were added to lyse the bacteria for 30 min at 4 °C with gentle rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM TCEP with 4% SYPRO Orange dye (Merck, #S5692) were filtered in SpinX tubes (Corning ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Merck) was added for nuclear staining and incubated at room temperature for 10 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 40 μg of protein was added to each well and run in Boric acid-Tris buffer (192 mM Boric acid, Merck; 1 mM EDTA, Merck; 0.1% SDS, to pH 7.6 with Tris) at 25 mA for 1.5 h ...
-
bioRxiv - Cell Biology 2024Quote: ... and counterstained with Fast Green (0.04% w/v in 1% acetic acid, Merck, Darmstadt, Germany).
-
bioRxiv - Cancer Biology 2024Quote: ... The reaction was stopped with the addition of 1% formic acid (Merck, 64-18-6) and peptides were dried in a SpeedVac ...
-
bioRxiv - Molecular Biology 2024Quote: ... HCT-8 cells were seeded at 2 x 10⁵ in 24-well plates and treated with the appropriate metabolites (cis-4,7,10,13,16,19-docosahexaenoic acid, creatine, 1-methylnicotinamide – all Merck). All metabolites used in this study were prepared by dissolving in water ...
-
bioRxiv - Genetics 2022Quote: ... or SD complete amino acid agar (0.67% yeast nitrogen base with amino acids (Merck), 2% glucose ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was supplemented with calcium chloride to a final concentration of 3 mM and chromatin was solubilised for 2 h at 4 °C by digestion with Turbonuclease (T4330, Merck) to a final concentration of 250U/ml ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dried pellet was mixed with Lysis buffer (9M urea, 4 wt% CHAPS, 2% Pharmalyte carrier ampholyte pH 3-10, Merck) and left overnight at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... To deplete Xrn1 and Dcp2 with the AID tags (Nishimura et al., 2009; Morawska and Ulrich, 2013) 1-Naphthaleneacetic acid (1-NAA; N0640-25G, Merck) was added to a final concentration of 1 mM ...
-
bioRxiv - Physiology 2022Quote: ... Phosphomolybdic Acid Orange G (Merck AG ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.01% pluronic acid (Merck) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 14% acetic acid (Merck). Plates were washed in water ...
-
bioRxiv - Microbiology 2020Quote: ... propionic acid (Merck, Darmstadt, Germany), n-valeric acid (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Pure oxalic acid (Merck, Germany) was identified by the retention time and was quantified by an external standard curve ...
-
bioRxiv - Microbiology 2022Quote: ... L-lactic acid (~90%, Merck), ethanol and glycerol were added to final concentrations of 40 mM ...
-
bioRxiv - Physiology 2022Quote: ... water and formic acid (Merck) in different proportions ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% Trifluoroacetic acid (TFA, Merck), 1 M glycolic acid (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... and L-ascorbic acid (Merck) supplemented with FGF2 (4 ug/mL ...
-
bioRxiv - Immunology 2023Quote: ... and concentrated sulfuric acid (Merck) for at least 30 minutes ...