Labshake search
Citations for Merck :
151 - 200 of 5704 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... peptides were dissolved at a concentration of 1 to 5 mg ml-1 in 1x PBS and incubated with TCEP agarose CL4-B (Merck) for 1 hour to reduce paired cysteines ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were then incubated for 5 min in a 1:1 mixture of propylene oxide (Sigma-Aldrich, Merck, Darmstadt, Germany) and absolute ethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... blots were blocked for 1 h and incubated overnight at 4 °C with anti-Amyloid fibrils (OC, 1:5000, Merck-Millipore), anti-prefibrillar oligomers (A11 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were centrifuged for 5 min at 20 000 x g and supernatants were immunoprecipitated for 1 h rotating at 4°C with mouse anti-GFP antibody (1 µg antibody per sample, 11814460001 Merck/Sigma) and 20 µl DynabeadsTM Protein G (10004D ...
-
bioRxiv - Synthetic Biology 2024Quote: ... IL) for 10 minutes, followed by base piranha cleaning (1:1:4 H2O2 (000855032300, Bio-Lab, IL):NH3 (105432, Merck, DE):H2O ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Cell Biology 2024Quote: RBC suspensions at 2-5% parasitaemia were stained using 5 µg/ml Hoechst (Merck # 94403) for 20 min at 37 °C protected from light to stain the DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktail 2 (1:1000) (Merck Life Sciences U.K. Ltd). Cell debris was removed from lysates via centrifugation (275 × g ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 % (v/v) 2-mercaptoethanol) and 25 U/mL Benzonase (Merck #70746).
-
bioRxiv - Neuroscience 2021Quote: ... 350 µl of a 1:100 dilution of 2-Mercaptoethanol (Merck, 8057400250), 250 µl insulin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-oligodendrocyte transcription factor 2 (Olig2) (Merck-Millipore, 1:200), rabbit polyclonal anti-ionized calcium-binding adapter 1 (Iba-1 ...
-
bioRxiv - Pathology 2023Quote: ... 1 µl of 10x TCEP (Tris(2-carboxyethyl)phosphine hydrochloride (#C4706, Merck) was added to the lid and mixed carefully ...
-
Investigation of a Novel Mouse Model of Prader-Willi Syndrome with Invalidation of Necdin and Magel2bioRxiv - Systems Biology 2024Quote: ... mouse anti-neurophysin 2 clone PS38 (1:1000, Ref# MABN844, Merck Millipore), rabbit anti-GnRH (1:3,000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Methanol extracts were diluted 1:5 in Milli-Q water (Merck, Darmstadt, Germany) and subjected to reversed phase HPLC-MS using an Accela 1250 HPLC system equipped with a Hypersil Gold aQ column and coupled to a QExactiveTM mass spectrometer (all from Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM β-mercaptoethanol and 1% (v/v) complete protease inhibitor cocktail (Merck). The protein concentration was quantified in crude extracts with the Bradford assay (Bradford ...
-
bioRxiv - Physiology 2024Quote: ... Mice also received Prednisolon (1 mg/kg diluted in 5 % glucose i.p., Merck) up to 10 days post-surgery to reduce the potential immune response to the LV-vectors.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... NMDA (1 µM, 10 µM or 20 µM, Merck, CAS 6384-92-5) was washed in through the perfusion system and the change of Ihold ...
-
bioRxiv - Biochemistry 2020Quote: ... actin was let to polymerize in PBS for 30 min at room temperature before adding 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholiniumchloride (DMTMM, MERCK) cross-linker ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked in 5% skim milk in TBS for 1 hour and probed with mouse γ/9d 2G10.2 (1:1000, MERCK MABT1335), rabbit anti mouse IgG (1:3000 ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 0.1% Tween-20 (PBS-T) and blocked using PBS supplemented with 4% w/v skimmed milk powder (PBSM-4%; Merck Millipore) for 1h at room temperature (RT) ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified ShTnsC was concentrated to 1-2 mg mL−1 using 30,000 kDa molecular weight cut-off centrifugal filters (Merck Millipore) and flash-frozen in liquid nitrogen.
-
bioRxiv - Immunology 2022Quote: ... and spleen were harvested and homogenated in PBS for CFU counting or in isotonic buffer (Tris HCl 50 nM, EDTA 2 mM, PMSF 1 mM [Roche Diagnostics GmbH], Triton X-100 1% [Merck Life Science] ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified ShTnsC was concentrated to 1-2 mg mL−1 using 30,000 molecular weight cut-off centrifugal filters (Merck Millipore) and flash-frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit mAb Phospho-MAPK (Erk 1/2 Thr202/Tyr204) (D13.14.4E) (1:1,000; #4370; Cell Signaling Technology, mouse mAb GAPDH (1;5000, G8795, MERCK/Sigma-Aldrich).
-
bioRxiv - Biochemistry 2021Quote: ... The cells were fixed for 1 h at room temperature with 4% buffered formalin solution containing 1% crystal violet (Merck, Darmstadt, Germany). Finally ...
-
bioRxiv - Microbiology 2021Quote: ... were diluted 1:500 in 4% bovine serum albumin (BSA) (Sigma-Aldrich, Merck, UK).
-
bioRxiv - Microbiology 2024Quote: ... and then treated with 1 mL of bleaching solution [4% Sodium hypochlorite (Merck 61842010001730) + 1N Sodium hydroxide (HiMedia MB095-100G ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVEC were treated with 500nM 5-Aza-2’-deoxycytidine (MERCK) dissolved in 0.9% NaCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 250 μM IdU (5-Iodo-2’-deoxyuridine, Merck, I7125) as described in the text ...
-
bioRxiv - Genetics 2023Quote: ... and CldU 100 μM (5-chloro-2’-deoxyuridine, C6891, MERCK). Cells were embedded in agarose block and DNA was prepared and combed on silanized coverslips ...
-
bioRxiv - Cell Biology 2024Quote: ... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were harvested 6 hours post transfection through the addition of 1 mL TRI reagent (Sigma-Aldrich, Merck) directly to the monolayer ...
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
bioRxiv - Developmental Biology 2021Quote: ... hsp70:R2nlsG double transgenic 5 dpf larvae were soaked in 10 µM 4-hydroxytamoxifen (4-OHT, Merck, Taufkirchen, Germany) or the corresponding amount of vehicle control ethanol for 10 h ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated o/n at 4°C with the primary antibodies (Rabbit-antiGFAP: MAB3402, Merck Millipore, 1:500; Mouse-antiNeuN: MAB377, Merck Millipore, 1:500) diluted in the blocking solution ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Growth experiments were performed on YNB medium with 1 or 2 % methanol supplemented with 1 g/L yeast extract (Merck 103753). Optical density readings at 600 nm (OD600 ...
-
bioRxiv - Immunology 2021Quote: Cytokine and chemokine levels produced by PCLS after 2 dpi were assessed in a Multiplex assay in supernatants (dilution 1:2) with MILLIPLEX® Bovine Cytokine/Chemokine Panel 1 (BCYT1-33K-PX15, Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and subsequently washed 4 times in Quencher solution (5 mM Trolox (Merck), 10 mM Na-Ascorbate (Merck)) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-Centrin-2 (1:250, clone 20H5, 04-1624, Merck Millipore), rabbit polyclonal anti-WDR90 (1:250 ...
-
bioRxiv - Microbiology 2022Quote: ... the samples were reduced by 1 mM tris(2-carboxyethyl)phosphine (TCEP, Merck) and free sulfhydryl groups carbamidomethylated using 5.5 mM chloroacetamide (Sigma-Aldrich) ...
-
Caloric restriction prevents inflammation and insulin dysfunction in middle-aged ovariectomized micebioRxiv - Physiology 2023Quote: ... 400 µL of 1% 2-thiobarbituric acid (TBA; Merck, St. Charles, MO, USA), and 200 µL of 20% phosphoric acid and heated at 100 °C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Nonspecific antibody blocking was for 1 h with 2% bovine serum albumin (Merck) in Tris-buffered saline ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-Vinculin (Clone H Vin 1 0, 2 Ml; Cat. #V9131) from Merck. Anti-HA-11 epitope tag ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 2 U mL−1 catalase from bovine liver (Merck-MilliPoreSigma, ref. C1345). NADH was added at a final concentration of 1 mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... H&L Chain Specific Peroxidase Conjugate (Merck, Cat#: 401215-2 ML, 1:5000), or Goat Anti-Rabbit IgG ...
-
bioRxiv - Cancer Biology 2024Quote: ... H & L Chain Specific Peroxidase Conjugate (Merck, Cat#: 401315-2 ML, 1:5000). Proteins were detected by chemiluminscent detection system (Tanon ...
-
bioRxiv - Synthetic Biology 2024Quote: ... followed by day 2 inoculation into 1 mL overnight autoinduction media (Merck, USA) with 50 µg/mL kanamycin ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.