Labshake search
Citations for Merck :
1901 - 1950 of 2709 citations for Mouse Anti Chikungunya Virus E2 Protein 18H01 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... alkylation and tryptic digestion (50 µg of protein per sample) was performed in centrifugal filters (Amicon Ultra-0.5, 30 kDa cut-off, Merck Millipore) according to the FASP protocol (Wiśniewski et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... and equal amount of protein were separated by SDS-PAGE and transferred to polyvinylidene difluoride membranes (Immobilon-P, Merck Millipore). Membranes were blocked for one hour in I-BlockTM (# T2015 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 500 μg of chimeric InvP protein in-solution and mixing with an equivalent volume of Freund’s complete adjuvant (Merck F5881). For the subsequent five booster doses ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitations were performed as previously described7 using Protein G Dynabeads (LifeTechnologies) coupled to Myc 4A6 antibody (Merck Millipore, 05-724) or FLAG M2 monoclonal antibody (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... Affinity-purified recombinant TrK13 proteins (WT, C580Y, R539T and C580Y) or commercially purchased BSA (A7030) or lysozyme (L6876) (Merck, Germany), each at 10 µM concentration ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were lysed in a protein extraction solution (∼10 µL/ mg tissue) consisting of 0.32M sucrose with protease inhibitors (Merck #4693159001) and phosphatase inhibitors (Pierce # A32957 ...
-
bioRxiv - Plant Biology 2024Quote: ... Calibration of the column was performed using the Gel Filtration Markers Kit for Protein Molecular Weights 12,000-200,000 Da (#MWGF200; Sigma-Aldrich/Merck, www.sigmaaldrich.com).
-
bioRxiv - Plant Biology 2024Quote: ... the purified protein was concentrated by centrifugation in 3 kDa cut-off filters (Amicon Ultra-15 Centrifugal Filter Units, Merck) at 4,500 x g ...
-
bioRxiv - Plant Biology 2024Quote: ... The purified protein was concentrated by centrifugation in 3 kDa cut-off filters (Amicon Ultra-15 Centrifugal Filter Units, Merck) at 4500 × g ...
-
bioRxiv - Plant Biology 2024Quote: ... Apoenzyme preparations of D-AAT and AtPLPHP1 were achieved by incubating 100 μM of purified protein with 75 mM D-cycloserine (Merck) in 50 mM HEPES pH 7.4 containing 300 mM sodium chloride on ice for 2 hours followed by buffer exchange as described above ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein concentration was quantified and 100ug proteins of each sample were incubated in acetonitrile with Sera-Mag SpeedBead Carboxylate-Modified Magnetic Particles (Hydrophilic) (#GE44152105050250, Merck) and Sera-Mag SpeedBead Carboxylate-Modified Magnetic Particles (Hydrophobic ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins in the lysate were then fractionated by SDS-PAGE and transferred to a PVDF membrane (Merck Millipore, Cat#IPVH00010). After blocking with 1% nonfat milk overnight at 4°C ...
-
bioRxiv - Plant Biology 2024Quote: ... the purified protein was concentrated by centrifugation in 3 kDa cut-off filters (Amicon Ultra-15 Centrifugal Filter Units, Merck) at 4,500 x g ...
-
bioRxiv - Biophysics 2024Quote: ... The protein was concentrated to 60 µM – 100 µM using an Amicon Ultra Centrifugal Filter Unit (30 kDa MWCO, Merck) and stored at −80 °C.
-
bioRxiv - Plant Biology 2021Quote: ... and added with 10 μl of the appropriate magnetic beads (anti-MyC beads, Thermo Fisher or anti-FLAG beads, Merck Millipore) and incubated for 1 hr at 4 °C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... stained with anti-human IFN-γ and anti-human IL2 antibodies for 40 min at RT in 0.2% saponin (Merck, Germany) in PBS (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated with primary antibodies diluted in blocking solution (anti-MAP2, 1:500, chicken, ab5392, Abcam; and anti-vGlut1 1:1000, guinea pig, AB5905, Merck Millipore) for 2 h at RT ...
-
bioRxiv - Cell Biology 2023Quote: Anti-Cortactin (p80/85) clone 4F11 (ref. n°05-180-I) and Anti-LAMP1 (ref. n°L1418) are from Merck (Sigma-Aldrich). Alexa FluorTM 488 Phalloidin (ref ...
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse LL/2 (LLC1; ATCC no. CRL-1642; obtained in 2015) was grown in BME with Earle′s salts (Merck) with the same supplementation as mentioned above ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Sections containing SN and VTA were incubated with antibodies directed against tyrosine hydroxylase (mouse monoclonal, 1:1000, Merck-Millipore MAB318) and mCherry (rabbit polyclonal ...
-
bioRxiv - Bioengineering 2020Quote: ... or mouse monoclonal β-actin antibody (1:1000 dilution; catalog no. catalog no. MAB 1501; Merck Millipore, Burlington, MA, USA) at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:10,000 WB) and mouse monoclonal antibody recognizing the N-terminus β-Actin (#A5441, 1:10,000 WB) were purchased from Merck. Rabbit polyclonal phosphomyosin (Thr18/Ser19 ...
-
bioRxiv - Cancer Biology 2023Quote: ... one mouse was exposed by drinking water to a mixture of BPA (1 µM, CAS no. 80-09-1, Merck) and DEHP (1 µM ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-NuMA1 clone AD6-1 (IF, WB) from Merck Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-GFP antibody 13.1 + 7.1 (Roche, Merck, Darmstadt, Germany) or anti-CSP repeat antibody – mAB 3D11 (Yoshida et al. ...
-
bioRxiv - Immunology 2021Quote: ... anti-human Caspase-1 antibody (06-503, Merck Millipore); anti-mouse IL-1β antibody (5129-100 ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-Cux1 (1:100, ABE217; Merck Millipore). Nuclei were stained using Hoechst 33258 (Nacalai Tesque) ...
-
bioRxiv - Genomics 2020Quote: ... were washed in IP-buffer and incubated with 4 μg anti-AP-1 (Thermo Scientific™ #MA5-15172)or anti-Sp1 Ab (ChIPAb+™ Merck #17-601) for 1 h at 4 °C on a rotating wheel ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-H3.3 (Merck Millipore 09-838, 1:1000). A peroxidase-conjugated antibody was used to reveal the proteins of interest with the Pierce ECL Western blotting substrate (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2019Quote: ... anti-prodynorphin guinea pig antibody (Merck Millipore, Billerica, MA) at 1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... or anti-dopa decarboxylase (1:500; AB1569; Merck Millipore), followed by 1-h incubation with secondary antibody goat anti-rabbit Alexa Fluor 680 (1:10,000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-phospho Histone H3 (1/500, 06-570, Merck), and anti-ZO-1 (1/50 ...
-
bioRxiv - Physiology 2021Quote: ... anti-Bcrp (1:100 – Bcrp [MAB4146]; Merck Millipore, USA), anti-Abcg1 (1:100 – [PA5-13462] ...
-
bioRxiv - Neuroscience 2020Quote: ... and rabbit anti-Tbr2 (1:1000, Merck Millipore, AB15894). Species-specific Cy2- ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were incubated with anti-Mena (Merck Millipore, #MAB2635) or anti-nesprin-2 (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... and goat anti-rat IgG HRP(1:5000; Merck); and goat anti-mouse IgG HRP (1:5000 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-c-terminal APP (1:1000, rabbit, A8717, Merck), anti-APP/Aβ (1:1000 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and anti-KLF17 (Sigma, HPA024629-100UL, Merck, Darmstadt, Germany), in PBS with 10% FBS addition ...
-
bioRxiv - Microbiology 2021Quote: ... or ANTI-Flag®M2 Affinity Gel (A2220, Merck) at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... with polyclonal goat anti-ChAT (AB144P; Merck; 1:150) and guinea pig anti-GnRH antibodies (#1018 ...
-
bioRxiv - Cell Biology 2020Quote: Anti-CD63 (CBL553, 1:1000) was acquired from Merck.
-
bioRxiv - Cancer Biology 2020Quote: ... using the anti-Puromycin (#MABE343; 1/5000) from Merck Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-GAPDH mab374 at 1/500 dilution (Merck); secondary #15014 at 1/10,000 (Active Motif).
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-MBP (1:300) (#MAB386, Merck-Millipore, Germany). After two washes in PBS ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... rabbit anti-Cep63 (Merck Millipore, MA, USA, 06-1292) at 1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... and probed for: RTN3 (rabbit polyclonal anti-RTN3; Merck Millipore #ABN1723 ...