Labshake search
Citations for Merck :
1801 - 1850 of 2552 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... The desired concentration was achieved using Amicon® Ultra centrifugal filter units (3 kDa cutoff – Merck Millipore).
-
bioRxiv - Immunology 2022Quote: ... for 1 hour at RT and washed 3 times with TBS/Tw (TBS containing 0.05% v/v Tween-20 (8.17072.1000, Merck)) ...
-
bioRxiv - Biochemistry 2022Quote: ... The aE11-Fab sample was concentrated by centrifugal concentrator with a MWCO of 3 kDa (Merck Millipore) and further purified by size exclusion chromatography into 20 mM Tris ...
-
bioRxiv - Cell Biology 2024Quote: ... they were washed four times for 3 minutes with PBS and mounted in Mowiol reagent (81381, Merck). The image acquisition was done on a Zeiss LSM880 confocal microscope running the software Zeiss ZEN2.3 SP1 FP3 (black ...
-
bioRxiv - Genomics 2024Quote: ... Traps deployed by BCC were also baited with 1-octen-3-ol (Merck Life Science, Bayswater, Australia) (van Essen et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... unreacted biotin-pentylamine was removed by ultrafiltration with a 3 or 10 kDa MWCO membrane (Merck Millipore). The recovered upper residual liquid (∼100 μL ...
-
bioRxiv - Systems Biology 2023Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument (PFPP-LC/MS/MS) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The gelatinous sack surrounding the eggs was removed by incubation in 3% L-Cysteine (Merck Millipore, USA) while rotated by hand for 15 minutes ...
-
bioRxiv - Immunology 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Biochemistry 2022Quote: ... Shimadzu) with a Discovery HS F5 column (2.1 mm i.d. × 150 mm, 3 μm particle size, Merck) coupled with a Q Exactive instrument ...
-
bioRxiv - Biochemistry 2022Quote: ... # T7408) using an ultrafiltration cartridge (Amicon Ultra 0.5 mL 3 K; Merck, Readington, NJ, USA; Cat. # UFC500324). The total protein levels in the samples were assayed using the Pierce™ BCA Protein Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cell extracts were concentrated using Amicon Ultra-15 3 kDa cutoff (Merck Millipore, Burlington, MA, USA). The obtained cell extract was flash-frozen in liquid nitrogen and preserved at −80 °C until further use.
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...
-
bioRxiv - Bioengineering 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APTS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... glutamine-free RPMI was supplemented with 2mM [1,5-15N]-L-Glutamine or [3-13C]-L-Glutamine (Merck).
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Cell Biology 2024Quote: ... The eluate from each column was pooled and concentrated in a 3 KD amicon column (Merck, UFC5003) to just under 100 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were later exposed to a 3% bovine serum albumin (BSA, A3912, Merck Life Science, Milan, Italy) solution in DPBS containing 0,1% Triton at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AQR-GFP plasmid (RG220742) was used for the mutagenesis with KOD polymerase (Merck/Millipore, 71086□3), used according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with rabbit-α-pH3Ser10 (1:250 for 3 hours at room temperature; Merck Millipore, Burlington, MA), incubated with goat-α-rabbit-AF568 (1:250 for 45 minutes at room temperature ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The gelatinous sack surrounding the eggs was removed using 4% L-Cysteine (Merck Milipore, USA) and followed by microinjecting the zygotes with Morpholino antisense oligonucleotide (MO) ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells fixed for 10 min with 4% paraformaldehyde (pH 7.0; prepared from paraformaldehyde powder (Merck) by heating in PBS up to 60 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... The recovered nanoparticles were pooled in Amicon Ultra-4 100 kDa centrifugal filter units (Merck) and concentrated by centrifuging at 2000 ×g until the lipid concentration was increased to 30–40 mM.
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated overnight at 4°C with mEM48 (1:500, Merck Millipore, Cat. # MAB5374) in 1% normal goat serum and 0.1% Triton-X-100 in TBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Mowiol® 4-88 used for mounting medium was purchased from Merck (Kenilworth, MJ, USA). Cell culture reagents – Ham’s-F12 ...
-
bioRxiv - Biochemistry 2021Quote: ... The purified complex I was concentrated using an Amicon Ultra-4 100K centrifugal filter (Merck) to 0.5 mg mL-1 (w/v) ...
-
bioRxiv - Biochemistry 2022Quote: ... After the standard procedure of Ni-NTA purification (Ni-NTA beads, Merck, cat. 70666-4) and Sumo protease cleavage (in-house production ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 % glycerol) freshly supplemented with 5µg/ml Poly(dI-dC) (Merck Life Science cat. P4929) and 0.5 mM DTT ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated overnight at 4 °C with primary antibodies (GSX2: rabbit 1:200, Merck-Millipore ABN162 ...
-
bioRxiv - Biochemistry 2021Quote: ... The active fraction was concentrated using a 50 kDa cutoff filter Amicon Ultra-4 (Merck), and of 20 μL was mixed with 2 μL of 5.9 mM coelenterazine and 278 μL of 20 mM Bis-Tris-HCl (pH 7.0) ...
-
Nerve pathology is prevented by linker proteins in mouse models for LAMA2-related muscular dystrophybioRxiv - Neuroscience 2022Quote: ... General histology was assessed after tissue fixation with 4% paraformaldehyde by H&E staining (Merck) or Picro Sirius Red stain (Direct Red 80 (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies used for ChIP were anti-H3K4me3 (Merck Millipore, 04–745, 4 μl per ChIP), anti-H3K27me3 (Merck Millipore ...
-
bioRxiv - Pathology 2020Quote: ... the harvested tissues were immediately fixed in 4% (w/v) paraformaldehyde (PFA; Merck, Darmstadt, Germany) for 24 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... After treatment for the indicated time the cells were fixed in 4% paraformaldehyde (Merck, 100496,) and permeabilized with cold methanol at −20°C for 2 min or 0.1% TX-100 in PBS for 5 min at room temperature followed by blocking with 0.12% glycine (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... 21,000 x g at 4°C and sterile-filtered using a 0.45µm PVDF-membrane (Merck).
-
bioRxiv - Cell Biology 2023Quote: ... sections were rehydrated and stained with haematoxylin (Fluka) for 4 min and with eosin (Merck) for 2 min ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.1% X-Gal (from a 4% X-Gal solution in dimethylformamide, Merck Life science). Buffer was passed through a 0.2 micron syringe filter before X-Gal was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... membranes were stained with Ponceau S and subsequently blocked in 4% BSA (A8022, Sigma/Merck) in 1x PBS-Tween (137 mM NACl ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 µM trans- Epoxysuccinyl-L-leucylamido(4-guanidino)butan (E64, Sigma-Aldrich, Merck, Taufkirchen, Germany) was added ...
-
bioRxiv - Immunology 2023Quote: ... cells were fixed for 30 min at 4°C with 0.4 % paraformaldehyde (PFA, Merck KGaA) and permeabilized by washing twice with permeabilization buffer (PBS containing 2 % FBS and 0.1 % saponin (Sigma)) ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 4 h with 5 mg/ml Brefeldin A (Merck, Darmstadt, Germany) after 140 h incubation time ...
-
bioRxiv - Molecular Biology 2022Quote: ... Rad54 was concentrated using an Amicon Ultra-4 (50 k) centrifugal filter (UFC805008, Merck Millipore).
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was then concentrated through an Amicon Ultra-4 Filter Unit (Merck, cat#UFC8100214). The validation of the cytoplasm fraction was performed by western blot using antibodies against markers for nucleus (H2A) ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions containing ELAC2 were concentrated using Amicon Ultra-4 30K Centrifugal Filter Devices (Merck Millipore), aliquoted ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies were applied overnight at 4°C (monoclonal anti–IdU 1:4000; SAB3701448, Merck). Sections were incubated in biotinylated secondary antibodies (Jackson ImmunoResearch Labs ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated o/n at 4°C with the primary antibodies (Rabbit-antiGFAP: MAB3402, Merck Millipore ...
-
bioRxiv - Biochemistry 2023Quote: ... After the standard Ni-NTA purification process using Ni-NTA beads (Merck, cat. 70666-4) and subsequent Sumo protease digestion (concentration of sumo protease at 1:200) ...