Labshake search
Citations for Merck :
1701 - 1750 of 6274 citations for 7 BROMO 2 3 4 5 TETRAHYDRO 1H BENZO E 1 4 DIAZEPINE 2 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 300 µL of aqueous phase was added to 500 µL of 2-propanol (Merck, Germany) and kept overnight at −20°C ...
-
bioRxiv - Cell Biology 2023Quote: After saponification with 2 mL 1M 95% ethanolic sodium hydroxide solution (Merck KGaA, Darmstadt, Germany) at 60°C for one hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... femurs and tibias in FACS buffer (PBS supplemented with 2% fetal calf serum (FCS; Merck) and 2 mM EDTA (Merck) ...
-
bioRxiv - Genetics 2023Quote: ... was added to each along with a single sterile 2 mm glass bead (Merck, Germany) to each tube ...
-
bioRxiv - Biophysics 2023Quote: ... RNA from yeast diluted in PBS (0.7 and 2 mg/mL; Sigma-Aldrich, Merck #10109223001).
-
bioRxiv - Bioengineering 2023Quote: ... followed by incubation in 10 mL of 2 U/mL dispase solution (D4693; Merck KGaA) at 4 °C overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was loaded onto a 2 ml column containing Ni-NTA His·Bind resin (Merck). The column was first washed with a solution containing 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2024Quote: ... diluted in RPMI 1640 medium supplemented 2 g/L of NaHCO3 (Merck®, Burlington, MA) and 10% fetal bovine serum (Gibco® ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membrane fractions were buffer-exchanged to PBS with Amicon Ultra 2-mL filters (Merck Millipore) and purified via FPLC with a Ni2+ column (Thermofisher).
-
bioRxiv - Neuroscience 2024Quote: ... and 0.12 U/μL RNase Inhibitor) inside a 2 mL Sorenson Dolphin microcentrifuge tube (Merck). The mixture containing the nuclei (800 μL ...
-
bioRxiv - Genetics 2024Quote: ... 0.25 M Tris(2-carboxyethyl) phosphine and 0.8M chloroacetamide dissolved in purified MilliQ water (Merck)) ...
-
bioRxiv - Biophysics 2020Quote: 19) Potassium chloride (KCl, Merck, CAS # 7447-40-7)
-
bioRxiv - Microbiology 2021Quote: ... Cuttings were transferred in magenta GA-7 vessels (Merck), incubated at 28°C ...
-
bioRxiv - Immunology 2022Quote: ... mouse CC1 Anti-APC (Ab-7) (#OP80-100UG, Merck) and mouse anti-Olig2 (#66513-1-IG ...
-
bioRxiv - Neuroscience 2022Quote: ... n-amyl acetate (AM; CAS: 628-63-7, Merck) diluted 1:20 in paraffin oil (CAS ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... either n-amylacetate (AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7% FBS (BioWest) and 10μg/mL Blasticidin hydrochloride (Merck)45.
-
bioRxiv - Microbiology 2024Quote: ... mouse mAb anti-HA (clone HA-7)(Merck, H3663) or 2 µg mouse IgG2a kappa isotype control (clone eBM2a ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Plant Biology 2023Quote: ... Acid digestion was performed by adding 9 mL of 69% nitric acid (HNO3) (Suprapur, Merck) and 1 mL of 30% hydrogen peroxide (H2O2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Whole cell extracts (500 μg per IP) were immunoprecipitated for 1h using a PHGDH-specific antibody (Merck Sigma, HPA021241) complexed with Dynabeads Protein A (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by 1% acetic acid for 30 seconds and Safranin’O solution for 45 min (S2255, Merck). For immunofluorescence ...
-
bioRxiv - Immunology 2023Quote: ... Bacterial cells processed via ultrasound and insoluble inclusion bodies were extracted with 1% deoxycholic acid (Merck) and 1% Triton X-100 (Merck ...
-
bioRxiv - Physiology 2024Quote: ... followed by 1% acetic acid for 30 seconds and Safranin’O solution for 45 min (S2255, Merck).
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Pathology 2023Quote: Cryosections of formalin-fixed lung tissue 7 μm thick were washed in PBS and permeabilized for 1 h with 0.01% Tween 20 (Sigma-Merck, Germany), followed by three washes in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were cryopreserved at a concentration of 4*106 cells/ml in 90% N2-S medium and 10% dimethyl sulfoxide (DMSO) (Merck Millipore ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... at 4°C in dialysis buffer (100 mM NaCl, 20mM Tris pH 7.4, containing 15 μl bovine thrombin (605157, Merck Millipore) to cleave the His-tags) ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysate was spun at 19650 x g for 20 min at 4 °C and the cleared supernatant was filtered in a 0.45 μm filter (Merck Millipore). M2 magnetic FLAG beads (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2019Quote: ... Tag cleavage was carried out overnight at 4 °C on a roller with 10 units of HRV 3C protease (Novagen/Merck chemicals Boulevard Industrial Park ...
-
bioRxiv - Biophysics 2019Quote: ... fractions containing monomeric PSCFP2*-AVI-3C-12xHis were concentrated using Amicon Ultra-4 centrifugal filters (10 kDa cut-off, Merck) in the presence of 100 µM Tris(2-carboxyethyl)phosphine (TCEP ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4°C) and the EV-depleted supernatant was filtered through a 0.22 μm pore PVDF Millex-HV filter (Merck Millipore) and analysed by NTA ...
-
bioRxiv - Microbiology 2021Quote: ... containing a knockout of DNA Ligase 4) 44 that had been made competent for DNA uptake using the LiCl2-based Yeast transformation kit (YEAST1-1KT; Merck). The transformed cells were plated on minimal synthetic defined (SD ...
-
bioRxiv - Biophysics 2020Quote: ... Further concentration and buffer exchange to 20 mM Tris-HCl pH 8.0 were carried out with 10kDa Amicon®Ultra-4 centrifugal filters (MERCK). The mixture of tetramers was then purified by anion exchange chromatography (MonoQ 5/50 GE Healthcare Life Sciences ...
-
bioRxiv - Biophysics 2021Quote: ... The resulting 5.6-mL fraction was concentrated to 250 μL by ultrafiltration using Amicon Ultra-4 10K centrifugal filters (Merck, USA), then submitted to immunodetection.
-
bioRxiv - Plant Biology 2021Quote: ... The cultured cells were collected by centrifugation (8,000 × g for 10 min at 4 °C) and suspended in BugBuster Protein Extraction Reagent according to the manufacturer’s procedures (Merck Millipore). The supernatant was collected by centrifugation (12,000 × g for 10 min at 4 °C) ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were further separated by size exclusion chromatography (HiLoad 26/600 Superdex 75, Cytiva) and concentrated using Ultra-4 or 15 mL centrifugal filter devices (Amicon, Merck). Correct size and high purity were verified via SDS-PAGE and LC-MS analysis ...
-
bioRxiv - Microbiology 2021Quote: ... Coverslips were washed ten times in PBS and ten times in ultrapure water before mounting on slides using Mowiol 4–88 (Merck) containing 200 nM 4′,6-diamidino-2-phenylindole (DAPI) ...
-
bioRxiv - Cell Biology 2022Quote: ... Filters were incubated in a cold room (4°C) overnight with primary antibodies diluted in PBS with 0.1% TWEEN® 20 (Merck) solution (1:1000 dilution) ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 4°C and the supernatant was taken for determining protein concentrations using a Direct Detect® Infrared Spectrometer (Merck). Whole lysate was used for subsequent analysis ...
-
bioRxiv - Systems Biology 2022Quote: ... The samples are placed in 3k cut-off centrifugal filters (Amicon Ultra −4 Centrifugal filters, Merck Millipore Ltd Cork, Ireland) and spun down at 4500 rpm for 25 minutes using a benchtop centrifuge ...
-
bioRxiv - Molecular Biology 2020Quote: ... with 1 % bovine serum albumin (BSA) and incubated overnight at 4 □ in TTBS with 0.1% BSA and the following primary antibodies: mPer1 (#AB2201, Merck Millipore), PER2 (#AB2202 ...
-
bioRxiv - Cancer Biology 2019Quote: 3D invasion cultures were washed with phosphate buffered saline pH 7.4 (PBS) once after removing medium and fixed with 4% neutral buffered formaldehyde (Merck, 1.94989.0521) for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... washed with PBS at room temperature before permeabilized for 30 min in PBS containing 0.1% Triton X-100 and 10% normal goat serum and incubated overnight at 4 °C in PBS containing 10% normal goat serum and primary antibodies: anti-Cytokeratin 14 (K14) antibody (SP53; Merck), anti-Neurofilament heavy polypeptide (NF200 ...