Labshake search
Citations for Merck :
1701 - 1750 of 1789 citations for 6 Chloro 2 trifluoromethyl 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: MDCK cells (2 x 105 cells) were cultured on polycarbonate Millicell culture plate inserts (12- mm diameter, 3-µm pore size; Merck Millipore) at 37°C under 5% CO2 atmosphere.
-
bioRxiv - Developmental Biology 2023Quote: Cells were homogenized in 20 mM Tris-HCl buffer (pH 7.2, 0.2 mM EGTA, 5 mM β-mercaptoethanol, 2% (v/v) antiprotease cocktail (Merck KGaA, Germany), 1 mM PMSF ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck, P5726-1ML and P0044-1ML, respectively) and 1:100 protease inhibitor cocktail (Sigma/Merck ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nuclei pellet was washed once in 5 mL of Honda buffer then purified on a Percoll density gradient as follows: 2 mL of 75% Percoll (Merck, P7828) in Honda buffer topped with 2 mL of 40% Percoll in Honda buffer topped with the nuclei pellet resuspended in Honda buffer in a 15 mL tube ...
-
bioRxiv - Biochemistry 2021Quote: ... PTP1B KO Ramos were transfected with a doxycycline inducible tet-on vector and exposed to 2 μg/ml doxycycline (Calbiochem, Merck, Darmstadt, Germany) 24 to 48 h before the experiment ...
-
bioRxiv - Cell Biology 2020Quote: ... for 3h at 16°C to remove the 6-His and MBP tag before phase separation in reaction mixtures in buffer C containing 10μM of WT or W1145R TopBP1b6-8-GFP and 2% of PEG4000 (Merck-Sigma-Aldrich, 95904). Reaction mixtures were mixed by gently tapping the Eppendorf ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa cells were allowed to adhere overnight (16 h) in the presence of 2 mM Thymidine (S-phase block; Merck, Darmstadt, Germany) and released into fresh medium ...
-
bioRxiv - Microbiology 2019Quote: ... Under these conditions nitrite was not detectable with a colorimetric test with a lower detection limit of 2 mg/L (MQuant test stripes, Merck, Darmstadt, Germany). Growth conditions and operation of the bioreactor containing ANME-2d archaea enriched from an Italian paddy field soil are described by Vaksmaa et al. ...
-
bioRxiv - Neuroscience 2021Quote: TEER across cellular monolayers was measured with chopstick electrodes in 24-well Transwell inserts using the Millicell® ERS-2 Voltohmmeter (Merck Millipore). The absolute TEER of eGFP-hCldn5-MDCK II cells before treatment was recorded as a baseline reading ...
-
bioRxiv - Neuroscience 2021Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Biochemistry 2021Quote: ... After adding 1 drop of bovine thrombin (Biomed, Lublin, Poland) to 2 drops of fibrinogen (1mg/ml; Sigma-Aldrich, St. Louis, MO; Merck KGaA) the cells were entrapped within the fibrin clots ...
-
bioRxiv - Biochemistry 2021Quote: ... and subsequent thorough rinsing with ultrapure water (18.2 MΩ at 25 °C, maximum 2 ppb total organic carbon, Milli-Q Integral 5 Water Purification System, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Biochemistry 2020Quote: DNA encoding for Pry1 and Na-ASP-2 were PCR amplified and cloned into NcoI and XhoI restriction sites of pET22b vector (Novagen, Merck, Darmstadt, Germany), which contains a pelB signal sequence to direct the secretion of expressed protein into the periplasmic space ...
-
bioRxiv - Cell Biology 2021Quote: ... ethanol and cut into 1–2 mm3 pieces and was cultured in Dulbecco’s modified Eagle medium (DMEM) (Sigma-Aldrich, Merck, Darmstadt, Germany) with 10% (v/v ...
-
bioRxiv - Neuroscience 2021Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Plant Biology 2021Quote: ... 1000 μl tips were fitted with 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 10 μg of LiChroprep® RP-18 peptides (Merck). Tips were sequentially equilibrated with 100 % methanol ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracted peptides were dried in a speed-vac and resuspended in (v/v) 2% acetonitrile/0.2% trifluoroacetic acid (Merck, catalog no. 302031). A total of four biological replicates for each sample type was submitted.
-
bioRxiv - Neuroscience 2020Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Neuroscience 2022Quote: ... were randomly assigned to receive an injection of 0.9% NaCl v/v 5-bromo-2’Deoxyuridine (BrdU) 100 mg/kg (MERCK; New York, USA) three times within the same day ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The protein was concentrated overnight to a volume of 2 mL in a Vivaspin 20 Ultrafiltration Unit (5 kDa MWCO)(Merck, Darmstadt, Germany) and then loaded onto a HiLoadTM 26/60 Superdex TM 75 prep grade (GE Healthcare ...
-
bioRxiv - Biochemistry 2021Quote: ... The total extract of proteins was then centrifuged for 20 min at 20,000 g and the soluble fraction loaded on an affinity chromatography with 2 ml of NiNTA resin (Sigma-Aldrich Merck, Darmstad Germany). The resin was washed with 20 ml of 20 mmol/L Tris-HCl (pH7.9 ...
-
bioRxiv - Cell Biology 2020Quote: ... All surrounding agarose was removed from the tissue and 2-3 tissue slices were positioned on each Millicell Cell Culture Insert (Merck Millipore, PICM0RG50) using No.22 scalpels (Swann-Morton ...
-
bioRxiv - Microbiology 2021Quote: IFN-α and IFN-β or IL-6 and TNF-α were measured in supernatants of AMs or lung lysates using IFN alpha/IFN beta 2-Plex Mouse ProcartaPlex™ immunoassay (ebiosciences) or Milliplex MAP Mouse™ assay (Merck), respectively ...
-
bioRxiv - Genomics 2021Quote: ... Each lobe was segmented so cryosections would fit on the 6,200 x 6,400 µm areas of the Codelink-activated microscope slides and frozen in −30°C 2-Methylbutane (Merck, cat.no.: M32631-1L). The frozen liver samples were embedded in cryomolds (10×10 mm ...
-
bioRxiv - Microbiology 2022Quote: ... Five duplicate plates were spread individually by six gradient diluted soil suspensions from 10−2 to 10−7 dilution on 1/10 TSA medium (Tryptic Soy Agar, Merck, Darmstadt, Germany) and incubated under both aerobic and anaerobic conditions at 28 °C for two weeks ...
-
bioRxiv - Immunology 2022Quote: ... type 2 and type 3 were mixed and subsequently concentrated using 10 kDa Amicon® Ultra Centrifugal Filters (Merck Millipore, Billerica, MA) to a nominal concentration of 10000-16000-32000 DU/mL.
-
bioRxiv - Plant Biology 2022Quote: ... disposable 200 μl pipette tips were fitted with 2 plugs of C18 octadecyl 47 mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were subjected to sonication on ice (10 cycles consisting of 10-s impulses at an output 10% followed by 20-s intervals) followed by incubation for 20 min at 37 °C in the presence of micrococcal nuclease (2 units/sample; Merck, cat. # N3755) and CaCl2 (at 10 mM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... (MW 360 kDa) and (Hydroxypropyl)-methylcellulose (HPMC) (viscosity 40-60 cP, 2 % in H2O (20 C) were purchased from Merck (Darmstadt, Germany). Methanol ...
-
bioRxiv - Neuroscience 2023Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Cell Biology 2023Quote: ... post-fixed in cooled ethanol:acetic acid (2:1) and stained using a TUNEL kit (ApopTag® Fluorescein In Situ Apoptosis Detection Kit, Merck Millipore, #S7110) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture was grown for 2 hr at 37°C and stocks were made from the original plate by adding glycerol (Merck & Co., USA) to the final concentration of 15% and stored at -70°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Media was concentrated further to a final volume of 1-2 ml using 10 KDa Amicon spin filters (Merck Millipore, MA, USA) by centrifugation at 3,500 g ...
-
bioRxiv - Neuroscience 2023Quote: Blood was collected in 2 ml EDTA tubes that were prepared with 100µl protease inhibitor (Pefabloc® SC Plus, Merck KGaA, Germany). These tubes were centrifuged immediately after venepuncture for 15 min at 4⁰C and 3200g ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated with 50 µM inhibitor (dissolved at 50 mM concentration in 100% DMSO) or 2 mM ATPψS (Merck Life Science UK) at room temperature for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 2 x 10 min in 100% ethanol) and subsequently incubated for 3 min in HMDS (Hexam-ethyldisilazane, Merck, Gillingham, UK) before quickly air drying the samples ...
-
bioRxiv - Biochemistry 2023Quote: ... samples were concentrated to a volume of approximately 2 mL using Amicon® Ultra centrifugal filters with a NMWC of 10 kDa (cat# UFC801024, Merck Millipore).
-
bioRxiv - Genetics 2023Quote: ... after adding 2 g activated (i.e., baked at 300°C for 2h) molecular sieves (5Å, 45-60 mesh size, Merck, KGaA, Darmstadt, Germany). The molecular sieves were filtered out by loading the extract into a glass funnel (50 mm inner diameter ...
-
bioRxiv - Neuroscience 2023Quote: The viability of SH-SY5Y cells after indicated treatments was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) assay ...