Labshake search
Citations for Merck :
1651 - 1700 of 2247 citations for Mouse Anti Yellow Fever Virus NS1 Antibody CE6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... anti-NeuN (A60, Merck Millipore, cat. no. MAB377) and anti-phospho-tau (AT8 ...
-
bioRxiv - Physiology 2023Quote: ... rabbit polyclonal anti-CaSR (SAB4503369, 1:100, Merck); mouse monoclonal anti-MAP2 (M1406 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-H2A (1/1000, Merck, 07-146), and rabbit anti-mono-ubiquitylated H2A (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-P2X7R (Merck Millipore, Milano, Italy cat. # AB5346), and anti-carbonic anhydrase II (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-phospho-histone H2AX (Ser 139) (3748823, Merck), anti-GFP (46825 ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-MyHC (Merck, #05-716, 1/200) and then with appropriate secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... or EZview Red Anti-HA Affinity Gel (Merck), 25 μl of slurry per sample ...
-
bioRxiv - Immunology 2023Quote: ... and anti-Phosphotyrosine (4G10, Merck Millipore, 05-321) at 1:400 ...
-
bioRxiv - Genetics 2022Quote: ... anti-3NT (1:200; Merck Millipore 06-284), anti-XOR (1:50 ...
-
bioRxiv - Genetics 2023Quote: ... Anti-ACTB was purchased from Merck (Darmstadt, Germany). Mice thymocytes or iPSCs were lysed with RIPA buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Mad1 clone BB3-8 (1:1000, Merck), anti-ZW10 (Rabbit ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Tyrosine hydroxylase (1:500, Merck, #AB152), and anti-MOAB2 (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... Goat Anti-Rabbit IgG HRP conjugate (632131/Merck/Massachusetts ...
-
Lowering mutant huntingtin by small molecules relieves Huntington’s disease symptoms and progressionbioRxiv - Molecular Biology 2023Quote: ... anti-PolyQ clone MW1 (1:1000; MABN2427, Merck) and anti-eIF4G1 for human samples (1:2000 ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Vinculin (1:1000; #V9131, Merck, Darmstadt, Germany); anti-SIRT4 (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Pre-washed anti-Flag M2 affinity gel (Merck) or EZview Red Anti-HA Affinity Gel (Merck) ...
-
bioRxiv - Cancer Biology 2024Quote: ... from Promega and Rabbit anti-Ph3 was obtained from Merck Millipore (06-570 used in 1:1000 dilution) ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-Synapsin1 (AB1543, 1:1,000; Merck Millipore), and mouse anti-PSD-95 (810401 ...
-
bioRxiv - Molecular Biology 2023Quote: ... PLA was performed using Duolink In Situ Red Starter kit (Mouse/Rabbit) according to the manufacturer protocol (Merck, DUO92101).
-
bioRxiv - Microbiology 2024Quote: ... insulin and proglucagon were measured using the Luminex™ Mouse Metabolic Hormone Expanded kit (Merck & Co., Inc. Kenilworth, NJ). Also ...
-
bioRxiv - Plant Biology 2021Quote: ... and added with 10 μl of the appropriate magnetic beads (anti-MyC beads, Thermo Fisher or anti-FLAG beads, Merck Millipore) and incubated for 1 hr at 4 °C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated with primary antibodies diluted in blocking solution (anti-MAP2, 1:500, chicken, ab5392, Abcam; and anti-vGlut1 1:1000, guinea pig, AB5905, Merck Millipore) for 2 h at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies used were CYFIP1/2 (Sra-1/PIR121 [14], Rac1/3 (23A8, Merck), Nap1 [14] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... For IP with guinea-pig antibody protein A-conjugated magnetic beads (Merck Millipore, LSKMAGA10) were used ...
-
bioRxiv - Neuroscience 2019Quote: ... slices were rinsed and incubated with secondary antibody (dilution 1:500; AP182C, Merck Millipore) diluted in 1% BSA TBST for 1-2h ...
-
bioRxiv - Biochemistry 2020Quote: ... Primary antibodies were used as follows: GST (1:1,000 dilution; Cat # 27457701V) from Merck, ubiquitin (1:1,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... Secondary antibody solutions were supplemented with 1 µg/mL DAPI solution (MBD0015; Merck KGaA) and 1 µg/mL BODIPY™ 493/503 dye (D3922 ...
-
bioRxiv - Microbiology 2022Quote: AB19026 ADAM10 rabbit polyclonal antibody (Immunogen: hADAM10 peptide 732-748) was purchased from Merck; anti-ADAM10 IC1427F was from R&D ...
-
bioRxiv - Genomics 2019Quote: ... The cells were incubated with an antibody against 8-oxoG (Merck KGaA, Darmstadt, Germany) diluted 1:200 in 0.05% Tween 20 in PBS for overnight at 4 °C ...
-
bioRxiv - Immunology 2020Quote: Antibody secreting cells (ASCs) were assayed in Multiscreen HA plates (Merck Milipore, Molsheim, France) coated with DT (10μg/mL) ...
-
bioRxiv - Microbiology 2022Quote: ... Antibodies were detected using the enhanced chemiluminescence system (Immobilon Forte Western HRP substrate, Merck) on the Amersham Imager 600 (GE Health Care Life Sciences) ...
-
bioRxiv - Neuroscience 2022Quote: ... and a polyclonal antibody against detyrosinated tubulin (1:1000; AB3201, Merck Millipore, Darmstadt, Germany) were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... with secondary antibodies diluted in blocking solution with 1% Hoechst 33258 (1:100, Merck). After three times washing with PBS ...
-
bioRxiv - Biophysics 2024Quote: ... the antibody was concentrated with an Amicon spin filter (MWCO 100 kDa, Merck, Germany) when the antibody concentration was below 2 mg/mL ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were stripped with 1X ReBlot Plus Strong Antibody Stripping Solution (#2504, Merck Millipore), blocked for 30 minutes in blocking milk ...
-
bioRxiv - Molecular Biology 2023Quote: ... the membranes were stripped using ReBlot Plus Mild Antibody Stripping Solution (Merck, Darmstadt, Germany), washed ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated with a primary antibody for phospho-Histone H2A.X Ser139 (JBW301, Merck) for 2 h at room temperature followed by a secondary antibody Anti-Mouse Alexa 555(A-21424 ...
-
bioRxiv - Physiology 2021Quote: ... For colocalization 1:100 anti-NBCe1 was incubated with 1:1,000 anti-Clara Cell Secretory Protein (CCSP; Merck Millipore cat#07-623) or 1:200 anti-alpha tubulin (Santa Cruz cat#sc-5286 ...
-
bioRxiv - Physiology 2024Quote: ... For colocalization 1:100 anti-CHRM3 was incubated with 1:500 anti-Clara Cell Secretory Protein (CCSP; Merck Millipore cat#07– 623), 1:200 anti-alpha tubulin (Santa Cruz ...
-
bioRxiv - Cell Biology 2023Quote: Anti-Cortactin (p80/85) clone 4F11 (ref. n°05-180-I) and Anti-LAMP1 (ref. n°L1418) are from Merck (Sigma-Aldrich). Alexa FluorTM 488 Phalloidin (ref ...
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse LL/2 (LLC1; ATCC no. CRL-1642; obtained in 2015) was grown in BME with Earle′s salts (Merck) with the same supplementation as mentioned above ...
-
bioRxiv - Cancer Biology 2023Quote: ... one mouse was exposed by drinking water to a mixture of BPA (1 µM, CAS no. 80-09-1, Merck) and DEHP (1 µM ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned the cytoplasmic domain of AChRα (mouse; amino acid 317-428) with or without mCherry into pGEX-4T1 (Cytiva 28-9545-49; Merck). GFP-SH3BP2 with or without the intrinsic disorder domain (amino acid 164-449 ...
-
bioRxiv - Neuroscience 2024Quote: ... the culture was stimulated by substituting one third of the medium with L929 medium (L929 mouse fibroblast cells had previously been plated in T175 cm2 cell culture flasks (Corning, Merck) with 100 mL culture medium (DMEM ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-NuMA1 clone AD6-1 (IF, WB) from Merck Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-Cux1 (1:100, ABE217; Merck Millipore). Nuclei were stained using Hoechst 33258 (Nacalai Tesque) ...
-
bioRxiv - Genomics 2020Quote: ... were washed in IP-buffer and incubated with 4 μg anti-AP-1 (Thermo Scientific™ #MA5-15172)or anti-Sp1 Ab (ChIPAb+™ Merck #17-601) for 1 h at 4 °C on a rotating wheel ...