Labshake search
Citations for Merck :
1651 - 1700 of 4455 citations for 7 Oxabicyclo 4.1.0 heptane 2 carboxylicacid 6 ethyl 1 methyl 5 oxo ethylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... pH 7.4 (Carl Roth),125 mM KCl (Merck),1 mM MgCl2 (Merck),1 mM EGTA/KOH pH 8.0 (Carl Roth),5% glycerol (Merck),1% NP-40 (Nonidet P 40 Substitute ...
-
bioRxiv - Pathology 2021Quote: ... 1 mM EDTA (Merck), 1% Triton X-100 ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% sucrose (Merck # 84100) and 2.5□mM morpholinoethanesulfonic acid (Euromedex # EU0033 ...
-
bioRxiv - Immunology 2021Quote: ... 1 % penicillin/streptomycin (Merck) and 1 % methylcellulose (Merck) ...
-
bioRxiv - Immunology 2020Quote: ... 1% NP-40 (Merck), 1m DDT (Merck) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1% PenStrep (Merck). Human SH-SY5Y neuroblastoma cells were cultured in DMEM/F-12 (ThermoFisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1% PenStrep (Merck). To induce apoptosis ...
-
bioRxiv - Microbiology 2022Quote: ... 1-iodododecane (Merck, 98%), potassium acetate (Th ...
-
bioRxiv - Bioengineering 2023Quote: ... + 1 % β-mercaptoethanol (Merck)).
-
bioRxiv - Genomics 2023Quote: ... 1% penicillin/streptomycin (Merck), 1x non-essential amino acids (PAA) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 mM DTT (Merck) and 500 mM imidazole (Merck) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 mM DTT (Merck), 20 mM imdidazole (Merck ...
-
bioRxiv - Microbiology 2023Quote: ... 1 M MgSO4 (Merck), 5 mg/mL cholesterol (HiMedia) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % penicillin/streptomycin (Merck), 1 % non- essential amino acids (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % penicillin/streptomycin (Merck), 1 % non- essential amino acids (Merck ...
-
bioRxiv - Biophysics 2023Quote: ... 1 mM MgCl2 (Merck), 20 mM HEPES (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 mM DTT (Merck), 10 μg/mL DNase I (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 mM DTT (Merck) and 0.01% Tween-20 (Merck) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 mM DTT (Merck), cOmplete ...
-
bioRxiv - Pathology 2023Quote: ... 1 M NaCl (Merck), 10% glycerol ...
-
bioRxiv - Cell Biology 2023Quote: ... Compound 1 (Merck/Astatech) was made up in DMSO and added to media at 25µM ...
-
bioRxiv - Immunology 2024Quote: ... Hoechst (1:5000, Merck) was added to the BMMC medium on top of the gel and incubated at 37°C and 5% CO2 for 3 h before imaging ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 μM FCCP (Merck) and 5 μM Rotenone and Antimycin (R/A ...
-
bioRxiv - Immunology 2024Quote: ... 1 mM KHCO3 (Merck), and 0.1 mM Na2-EDTA (Merck ...
-
bioRxiv - Immunology 2023Quote: ... 1 mM KHCO3 (Merck), and 0.1 mM Na2-EDTA (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 % adenine (#A2786, Merck), 1 % T3/transferrin solution (#T8158 ...
-
bioRxiv - Cell Biology 2020Quote: Epithelial canine MDCK II (CRL2936) cells were obtained from the ATCC and grown in MEM supplemented with 5% FBS (Merck) at 37°C in an atmosphere of 5% CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... PBMCs (2 × 106 cells) were plated onto 48-well plates (NalgeNunc) in RPMI-1640 with 5% inactivated male human AB serum (Merck) for 3 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with FITC (Fluorescein isothiocyanate) conjugated secondary antibody (0.5 μg/ml of Goat Anti-Mouse IgG-FITC in 5%BSA) (GeNei, Merck, USA) (Cat.no ...
-
bioRxiv - Developmental Biology 2021Quote: ... they were washed again in PBS (three times, each for 5 min) and mounted with antifade solution (Cat.no. S7114, Sigmsa-Aldrich, Merck, USA). Images were acquired using a Leica DM 2500 fluorescent microscope (Leica ...
-
bioRxiv - Microbiology 2020Quote: ... 5×106 cells from treated and untreated conditions were centrifuged for 5 min at 4,500 g and the pellets were resuspended in 4% paraformaldehyde (PFA, Merck, Germany), and incubated for 20 min ...
-
bioRxiv - Microbiology 2019Quote: ... and bacterial pellets were resuspended in 5 ml of cold column buffer with 1x PIC (Protease inhibitor cocktail set I; Cat. Nr. 539131-10VL, Merck) and 200 mM PMSF (Cat ...
-
bioRxiv - Bioengineering 2019Quote: Fixed samples were centrifuged at 1,957 x g for 5 min at room temperature and re-suspended in cold Milli-Q water (Merck-Millipore) (4°C) ...
-
bioRxiv - Physiology 2021Quote: ... with 0.2 % m/v Triton-X100 and 5% Normal Goat Serum (m/v) (S26-LITER, Merck Life Science UK LTD) (PBST.NGS ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Cell Biology 2021Quote: ... HL-60 and MS-5 cells cultured alone and in co-culture were incubated for 24 hours in 50 μM H2O2 (Merck) complete cell culture medium ...
-
bioRxiv - Microbiology 2021Quote: ... Identification of metabolites for LC-MS was performed with a ZIC pHILIC column (150 mm × 4.6 mm, 5 μm column, Merck Sequant) coupled to high-resolution Thermo Orbitrap QExactive (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... chromatographic separation was performed on ZIC-pHILIC column equipped with a guard (5 µm, 4.6 × 150 mm, SeQuant®, Merck). The mobile phase (A ...
-
bioRxiv - Biophysics 2020Quote: ... 50 μL of sample was injected onto a Discovery BIO Wide Pore C18 column (15 cm x 4.6 mm, 5 μm column with a guard column) (Supelco, Merck, UK) and eluted on a gradient of 95% water + 0.1% acetic acid and 5% acetonitrile + 0.1% acetic acid to 5% water + 0.1% acetic acid and 95% acetonitrile + 0.1% acetic acid at a 0.8 mL/min flow-rate over 40 mins ...
-
miR-206 inhibits estrogen-induced proliferation and invasion of ER-α36 positive gastric cancer cellsbioRxiv - Cancer Biology 2021Quote: ... 20 μL of the MTT solution was added to each well (5 mg/ml, Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Then ...
-
bioRxiv - Cell Biology 2021Quote: ... against a final buffer (20mM Hepes, 200 mM NaCl, 5% Glicerol, 2mM DTT) and concentrated with appropriate MW cut-off Vivaspin columns (Merck). The concentration of purified proteins was determined by colorimetric assay (Bio-Rad DC Protein Assay ...
-
bioRxiv - Cell Biology 2021Quote: The samples were loaded onto a 5–20% gradient SDS-PAGE gel (Wako, Osaka, Japan) and transferred to an Immobilon-P Transfer Membrane (Merck). Antibodies were diluted with Signal Enhancer HIKARI for Western Blotting and ELISA (Nacalai Tesque) ...
-
bioRxiv - Microbiology 2022Quote: ... Separation in the HPLC was carried out using a SeQuant ZIC-pHILIC column (PEEK 150 × 2,1 mm, 5 μm, 110 Å, Merck) at 30 °C with an CH3CN (buffer A ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were incubated for 72h with the indicated concentrations of the respective drugs and further incubated for 3h with 5 mg/ml MTT (Merck). Finally ...
-
bioRxiv - Pathology 2019Quote: ... For MALDI-TOF/TOF/MS analysis dried peptides were dissolved in peptide resuspension solution (0.1% TFA in 5% ACN) and desalted/concentrated using C18 zip tips (Merck Millipore) as per the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Nuclei were pelleted by centrifugation at 3000 rpm for 5 min at 4°C and were resuspended in hypotonic buffer containing 1U/µl of benzonase (Merck). Extracts were incubated on ice for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... Chromatographic separation was achieved using a silica-based SeQuant ZIC-pHILIC column (2.1 mm × 150 mm, 5 µm, Merck, Germany) with elution buffers consisting of (A ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were blocked using 5% non-fat dry milk in Tris-buffered saline with 0.1% Tween 20 (655204, Merck Millipore) and probed with the respective primary and secondary antibodies ...