Labshake search
Citations for Merck :
1601 - 1650 of 2466 citations for 5 Bromobenzothiazole 2 sulfonic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The heptose-phosphates were separated by a SeQuant ZIC-pHILIC (5 µm, 150×2.1 mm) column (Merck). Solvent A ...
-
bioRxiv - Genetics 2023Quote: ... At L4 larval stage animals were transferred to plates containing 10 µM of 5-Fluorouracil (Merck, #F6627) to prevent progeny production ...
-
bioRxiv - Microbiology 2023Quote: ... 5% H2) at 37°C in Bacteroides minimal medium (BMM) containing 27.5 μM of iron (FeSO4, Merck)91 ...
-
bioRxiv - Cancer Biology 2023Quote: PEGylated-poly(T)-coated coverslips were assembled as described and further passivated with 5% BSA (Merck, A7906) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 250-mm long) using an acetonitrile gradient (5–35% acetonitrile for 160 min, Merck KGaA, Darmstadt, Germany) in the presence of 0.1% formic acid at a flow rate of 250 nl/min ...
-
bioRxiv - Biophysics 2024Quote: ... mN2GCH was concentrated down to 500 μl using an Amicon Ultra 5 centrifugal filters (Merck, Darmdstad, Germany) and then injected onto a Superdex 200 10/300 GL column (Sigma-Aldritch ...
-
bioRxiv - Molecular Biology 2024Quote: ... equal amounts of 100 μM 5’-Cy5 labelled forward strand and unlabelled reverse strand oligonucleotides (Evrogen/Merck) were mixed in the annealing buffer (10 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Immunology 2024Quote: ... slides were washed with PBS and counterstained with a Hoechst-34580 DNA dye (5 μg/mL; Merck) in some cases supplemented with combinations of UEA1 Atto 488-conjugated lectin (10 µg/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were permeabilized for 5 minutes with DPBS containing Triton 0,1% (X100, Merck Life Science, Milan, Italy). To prevent non-specific binding of the antibody ...
-
bioRxiv - Microbiology 2024Quote: ... a stock citrate solution of 5 mg/mL was prepared by using tri-sodium-citrate dihydrate (MERCK). Then ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cancer Biology 2024Quote: ... and treated for 24h with 10 μM Nutlin 3a and/or 5 μg/ml 17β-Estradiol (Merck). Four independent experiments were performed ...
-
bioRxiv - Neuroscience 2024Quote: ... diluted (1:500) in a TBST with 5% non-fat milk or with anti-GAPDH (Merck, #MAB374) diluted 1:25000 in 5% bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2024Quote: ... which then were transferred into 4-5 fold bigger volume of cOmpleteTM Protease Inhibitor Cocktail (Roche, Merck) in PBS and gently mixed for 30 minutes to aid HA dilution ...
-
bioRxiv - Biochemistry 2024Quote: ... The samples were separated using mPAGE 12% Bis-Tris gels (Merck; 5 μl loading volume per sample) with MOPS running buffer (50 mM MOPS ...
-
bioRxiv - Molecular Biology 2021Quote: WT MtbRho and the M495L mutant were overexpressed in Rosetta 2(DE3) cells (Merck-Millipore) harboring the appropriate pET28b derivative and purified following published protocols35 with minor modifications ...
-
bioRxiv - Biochemistry 2021Quote: Ethanol (absolute for analysis) and 2-propanol (for analysis) were obtained from Merck (Darmstadt, Germany). Sodium chloride (≥99.8%) ...
-
bioRxiv - Cell Biology 2021Quote: ... Intracellularly applied drug: the membrane impermeable G-protein blocker GDP-β-S (2 mM, Merck) (Farkas et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... at a final concentration of 10 ng/ml and phosphatase inhibitor cocktail-2 (P5726, Merck) at 1% (v/v) ...
-
bioRxiv - Immunology 2022Quote: ... EB retained in the brain tissue was extracted by immersion in 2 ml formamide (Merck) at 37°C in the dark for 48 h ...
-
bioRxiv - Biochemistry 2022Quote: ... and the cells grown in 2 L of Overnight Express Instant LB medium (Merck, Germany) containing 100 μg/ml ampicillin at 28 °C for approximately 32 h ...
-
bioRxiv - Biophysics 2022Quote: ... bis-acrylamide (2% w/w) and ammonium persulfate (0.05% w/v) (all from Merck, Germany) in 10 mM Tris-buffer (pH 7.48) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell-free samples were fixed for 1 hour at room temperature with 2% glutaraldehyde (Merck) in 0.1M cacodylate buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 μL of extract containing total lipids were separated on TLC (Silica Gel 60, Merck) by using petroleum ether:diethyl ether (90:10 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos from in vitro culture were fixed in a solution containing 2% paraformaldehyde (PFA, Merck) for 20 min at 37° C [41] and ex vivo flushed embryos were fixed in 4% PFA over night at 4° C ...
-
bioRxiv - Immunology 2022Quote: Nose and throat swabs were collected in 2 ml transport medium containing 15% sucrose (Merck), 2.5 µg/ml Amphotericin B ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of terminated reaction mix were spotted onto polyethyl-enimine-cellulose plates (Merck, Germany). ATP and released phosphate were then separated chromatographically in a buffer of 0.5 M LiCl ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Microbiology 2023Quote: ... 300 μL of aqueous phase was added to 500 μL of 2-propanol (Merck, Germany) and kept overnight at −20°C for RNA precipitation ...
-
bioRxiv - Microbiology 2022Quote: ... After testing for SARS-CoV-2 by PCR test (COBAS 6800, Merck México, Mexico city), they were classified as positive (AP ...
-
bioRxiv - Microbiology 2022Quote: ... Maize was cultured in ¼ Hoagland’s medium (Hoagland’s No. 2 Basal Salt Mixture, Sigma-Aldrich/Merck), pH adjusted to 5.6-5.8 with KOH ...
-
bioRxiv - Neuroscience 2022Quote: ... Two hundred microliters of medium containing 2 μM human insulin (Merck, Sigma-Aldrich Cat# I9278) or medium only was added to the thoraxes for 10 min (the final concentration of insulin was 1 μM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and protein complex was eluted in lysis buffer 2 containing 2.5 mM D-desthiobiotin (Merck). Protein tags were removed by overnight cleavage with HRV 3C protease ...
-
bioRxiv - Microbiology 2023Quote: ... transepithelial electric resistance (TEER) measurements were performed using a Millicell ERS-2 Voltohmmeter (Merck-Millipore) equipped with an Ag/AgCl electrode (STX01 ...
-
bioRxiv - Cancer Biology 2023Quote: Samples were prepared with hot reducing SDS sample buffer containing 2-mercaptoethanol (Merck, Darmstadt, Germany) and loaded onto a 15 % SDS polyacrylamide gel to separate the proteins according to their size ...
-
bioRxiv - Microbiology 2023Quote: All compounds (zaprinast, heparin, artemisinin, chloroquine, brefeldin A and Torin 2) were sourced from Merck KGaA ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti tyrosinated-α-tubulin 1:250 (MAB1864-I, clone YL1/2, EMD Millipore/Merck), mouse anti-Armadillo/β-Catenin 1:50 (N27A1 ...
-
bioRxiv - Microbiology 2023Quote: ... 300 µL of aqueous phase was added to 500 µL of 2-propanol (Merck, Germany) and kept overnight at −20°C ...
-
bioRxiv - Cell Biology 2023Quote: After saponification with 2 mL 1M 95% ethanolic sodium hydroxide solution (Merck KGaA, Darmstadt, Germany) at 60°C for one hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... femurs and tibias in FACS buffer (PBS supplemented with 2% fetal calf serum (FCS; Merck) and 2 mM EDTA (Merck) ...
-
bioRxiv - Genetics 2023Quote: ... was added to each along with a single sterile 2 mm glass bead (Merck, Germany) to each tube ...
-
bioRxiv - Biophysics 2023Quote: ... RNA from yeast diluted in PBS (0.7 and 2 mg/mL; Sigma-Aldrich, Merck #10109223001).
-
bioRxiv - Bioengineering 2023Quote: ... followed by incubation in 10 mL of 2 U/mL dispase solution (D4693; Merck KGaA) at 4 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was loaded onto a 2 ml column containing Ni-NTA His·Bind resin (Merck). The column was first washed with a solution containing 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membrane fractions were buffer-exchanged to PBS with Amicon Ultra 2-mL filters (Merck Millipore) and purified via FPLC with a Ni2+ column (Thermofisher).
-
bioRxiv - Neuroscience 2024Quote: ... and 0.12 U/μL RNase Inhibitor) inside a 2 mL Sorenson Dolphin microcentrifuge tube (Merck). The mixture containing the nuclei (800 μL ...
-
bioRxiv - Genetics 2024Quote: ... 0.25 M Tris(2-carboxyethyl) phosphine and 0.8M chloroacetamide dissolved in purified MilliQ water (Merck)) ...