Labshake search
Citations for Merck :
1601 - 1650 of 1707 citations for 3 2 Methoxy phenoxymethyl piperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nuclei pellet was washed once in 5 mL of Honda buffer then purified on a Percoll density gradient as follows: 2 mL of 75% Percoll (Merck, P7828) in Honda buffer topped with 2 mL of 40% Percoll in Honda buffer topped with the nuclei pellet resuspended in Honda buffer in a 15 mL tube ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 5,000 Da ...
-
bioRxiv - Cell Biology 2022Quote: ... femurs and tibias of C57BL/6J mice were extracted and crushed on a mortar in PBS supplemented with 4%FBS and 2 mM EDTA and filtered through 0.45μm strainers (Merck Millipore, Cat#SLHV033RB). For B cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Plant Biology 2023Quote: ... and concentrated to 2 mg chlorophyll mL-1 using a 100-kDa molecular-weight cut-off centrifugal filter unit (Amicon Ultra-15, Merck Millipore). A 3 µl volume of the sample was applied to a glow-discharged holey carbon grid (GIG ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Zoology 2023Quote: ... it was fractionated into the different fatty acid classes over an activated silicic acid column (heated at 120ºC for 2 h; Merck Kieselgel 60) via eluting with 7 ml chloroform ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: Cells were homogenized in 20 mM Tris-HCl buffer (pH 7.2, 0.2 mM EGTA, 5 mM β-mercaptoethanol, 2% (v/v) antiprotease cocktail (Merck KGaA, Germany), 1 mM PMSF ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Microbiology 2024Quote: ... (Loba Chemie, India), nickel (Nickel Chloride Hexahydrate, NiCl2.6H2O) (Loba Chemie, India), and lead (Lead Nitrate, Pb(NO3)2) (Merck Chemicals, India) at a concentration of 100µg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... 4 mM MgCl2 (optimal ATP to MgCl2 ratio), 0.2 mM NADH, 2 mM PEP, 8 U PK (rabbit muscle, (Merck, Darmstadt, Germany)) ...
-
bioRxiv - Immunology 2024Quote: ... and EV- containing fractions were pooled and concentrated to 2 ml with 10 kDa molecular weight cut-off Amicon centrifugal filter units (Merck Millipore). For the proteomic analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... the elution of the biotinylated proteins was carried out boiling the beads in 25 μl of 3X protein loading buffer supplemented with 20 mM DTT and 2 mM Biotin (Merck, B4501) for 10 min at 95°C in gentle shaking ...
-
bioRxiv - Microbiology 2024Quote: ... ParT (S48C)-His6 and ParT (Q271C)-His6 aliquots were supplemented with 1 mM tris (2-carboxyethyl) phosphine hydrochloride (Merck; cat# C4706) before flash-freezing in liquid nitrogen.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and then the salts of PBS were removed using the Amicon Ultra-2 centrifugal filter units from Merck (New Jersey, USA). The sample was added on a formvar-coated carbon grid ...
-
bioRxiv - Biochemistry 2024Quote: ... 18 µL of a 20 µM solution of LmPDTN56C was mixed with 2 µL 100x SYPRO Orange (Merck kGaA, Darmstadt, Germany). The samples were then subjected to a temperature ramp spanning from 35 to 95 °C at 1 °C/min recording the fluorescent emission (Exc ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 million cells per mL were suspended in 1 mL of a 1.2% sodium alginate solution (Merck, Saint-Quentin-Fallavier, France). Beads were formed by dripping the cell suspension into a sterile 100 mM CaCl₂ solution (VWR ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell culture media was changed to FCS-free high glucose DMEM containing 12.5 µM 13C16-labelled or unlabelled palmitate conjugated to 2% fatty acid-free bovine serum albumin (BSA, Merck Life Sciences). Palmitate was prepared in cell culture media from 100 mM ethanolic stocks of palmitic acid and conjugated to fatty acid-free BSA by incubating at 55°C in media for 2 h ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were picked from a single colony and grown overnight in -Ura synthetic minimal media (2 g/L Yeast Synthetic Drop-out Medium Supplement without uracil (Merck #1501), 67 g/L Yeast Nitrogen Base Without Amino Acids (Merck #Y0626) ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions were analyzed by SDS-PAGE and those containing h15-LOX-2 were pooled and concentrated with an Amicon Ultra Centrifugal Filter (30 kDa cutoff) (Merck, Germany). Finally ...
-
bioRxiv - Biochemistry 2021Quote: ... PTP1B KO Ramos were transfected with a doxycycline inducible tet-on vector and exposed to 2 μg/ml doxycycline (Calbiochem, Merck, Darmstadt, Germany) 24 to 48 h before the experiment ...
-
bioRxiv - Cell Biology 2020Quote: ... for 3h at 16°C to remove the 6-His and MBP tag before phase separation in reaction mixtures in buffer C containing 10μM of WT or W1145R TopBP1b6-8-GFP and 2% of PEG4000 (Merck-Sigma-Aldrich, 95904). Reaction mixtures were mixed by gently tapping the Eppendorf ...
-
bioRxiv - Neuroscience 2021Quote: TEER across cellular monolayers was measured with chopstick electrodes in 24-well Transwell inserts using the Millicell® ERS-2 Voltohmmeter (Merck Millipore). The absolute TEER of eGFP-hCldn5-MDCK II cells before treatment was recorded as a baseline reading ...
-
bioRxiv - Immunology 2020Quote: Survival was determined by assessing the fraction of vital cells at defined time points during culture by flow cytometric exclusion of 4’,6-Diamidin-2-phenylindol (DAPI) (Merck, Darmstadt, Germany) and Annexin V-APC (BD Biosciences ...
-
bioRxiv - Neuroscience 2021Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Biochemistry 2021Quote: ... After adding 1 drop of bovine thrombin (Biomed, Lublin, Poland) to 2 drops of fibrinogen (1mg/ml; Sigma-Aldrich, St. Louis, MO; Merck KGaA) the cells were entrapped within the fibrin clots ...
-
bioRxiv - Biochemistry 2021Quote: ... and subsequent thorough rinsing with ultrapure water (18.2 MΩ at 25 °C, maximum 2 ppb total organic carbon, Milli-Q Integral 5 Water Purification System, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Biochemistry 2020Quote: DNA encoding for Pry1 and Na-ASP-2 were PCR amplified and cloned into NcoI and XhoI restriction sites of pET22b vector (Novagen, Merck, Darmstadt, Germany), which contains a pelB signal sequence to direct the secretion of expressed protein into the periplasmic space ...
-
bioRxiv - Cell Biology 2021Quote: ... ethanol and cut into 1–2 mm3 pieces and was cultured in Dulbecco’s modified Eagle medium (DMEM) (Sigma-Aldrich, Merck, Darmstadt, Germany) with 10% (v/v ...
-
bioRxiv - Neuroscience 2021Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Plant Biology 2021Quote: ... 1000 μl tips were fitted with 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 10 μg of LiChroprep® RP-18 peptides (Merck). Tips were sequentially equilibrated with 100 % methanol ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracted peptides were dried in a speed-vac and resuspended in (v/v) 2% acetonitrile/0.2% trifluoroacetic acid (Merck, catalog no. 302031). A total of four biological replicates for each sample type was submitted.
-
bioRxiv - Neuroscience 2020Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Neuroscience 2022Quote: ... were randomly assigned to receive an injection of 0.9% NaCl v/v 5-bromo-2’Deoxyuridine (BrdU) 100 mg/kg (MERCK; New York, USA) three times within the same day ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The protein was concentrated overnight to a volume of 2 mL in a Vivaspin 20 Ultrafiltration Unit (5 kDa MWCO)(Merck, Darmstadt, Germany) and then loaded onto a HiLoadTM 26/60 Superdex TM 75 prep grade (GE Healthcare ...
-
bioRxiv - Biochemistry 2021Quote: ... The total extract of proteins was then centrifuged for 20 min at 20,000 g and the soluble fraction loaded on an affinity chromatography with 2 ml of NiNTA resin (Sigma-Aldrich Merck, Darmstad Germany). The resin was washed with 20 ml of 20 mmol/L Tris-HCl (pH7.9 ...
-
bioRxiv - Biophysics 2020Quote: Upon deposition the samples were washed 2 times 15 minutes with PBS prior to overnight fixation with 4% paraformaldehyde (PFA, Merck, Darmstadt, Germany). Washing steps and incubation took place under agitation at 4 °C unless stated otherwise ...
-
bioRxiv - Microbiology 2021Quote: IFN-α and IFN-β or IL-6 and TNF-α were measured in supernatants of AMs or lung lysates using IFN alpha/IFN beta 2-Plex Mouse ProcartaPlex™ immunoassay (ebiosciences) or Milliplex MAP Mouse™ assay (Merck), respectively ...
-
bioRxiv - Genomics 2021Quote: ... Each lobe was segmented so cryosections would fit on the 6,200 x 6,400 µm areas of the Codelink-activated microscope slides and frozen in −30°C 2-Methylbutane (Merck, cat.no.: M32631-1L). The frozen liver samples were embedded in cryomolds (10×10 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Cell Biology 2023Quote: ... post-fixed in cooled ethanol:acetic acid (2:1) and stained using a TUNEL kit (ApopTag® Fluorescein In Situ Apoptosis Detection Kit, Merck Millipore, #S7110) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture was grown for 2 hr at 37°C and stocks were made from the original plate by adding glycerol (Merck & Co., USA) to the final concentration of 15% and stored at -70°C ...