Labshake search
Citations for Merck :
1551 - 1600 of 2574 citations for Mouse anti Plasmodium vivax CSP PVC 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... PLA was performed using Duolink In Situ Red Starter kit (Mouse/Rabbit) according to the manufacturer protocol (Merck, DUO92101).
-
bioRxiv - Plant Biology 2021Quote: ... and added with 10 μl of the appropriate magnetic beads (anti-MyC beads, Thermo Fisher or anti-FLAG beads, Merck Millipore) and incubated for 1 hr at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... stained with anti-human IFN-γ and anti-human IL2 antibodies for 40 min at RT in 0.2% saponin (Merck, Germany) in PBS (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated with primary antibodies diluted in blocking solution (anti-MAP2, 1:500, chicken, ab5392, Abcam; and anti-vGlut1 1:1000, guinea pig, AB5905, Merck Millipore) for 2 h at RT ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant protein expression was performed using Eschericia coli strain Rosetta™ 2 (DE3) (Novagen) (Merck Cat. No 71403). Protein expression was always performed using freshly transformed chemically competent E ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were seeded (2×104 cells/well) in 24-well plates in alphaMEM medium (Merck, Darmstadt, Germany, #F0925) plus 10 % FCS (Gibco ...
-
bioRxiv - Genomics 2019Quote: The populations were enriched in metaphasic cells by 2 h of treatment with 200 nM nocodazole (Merck, M1404) prior to cell recovery ...
-
bioRxiv - Plant Biology 2021Quote: 2-AA-labeled N-glycans prepared for HILIC-HPLC were desalted on C18 ZipTips (Millipore, Merck, Warszawa, Poland), following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... for 2 hours at 37°C and purified using an Amicon 30 kDa MWCO filter (Merck, Darmstadt, Germany). The Deep Vent exo- DNA polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed 2 twice with PBS and were permeabilized with PBS–0.06%-Triton X-100 (Merck, USA) for 10 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... medium was replaced with the culture medium containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Biophysics 2022Quote: ... for 2 hours at 37°C and purified using an Amicon 30 kDa MWCO filter (Merck, Darmstadt, Germany). Deep Vent exo-DNA polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: AKT1/2 phosphorylation was inhibited with InSolution™ Akt Inhibitor VIII (1-10 µM, Merck KGaA, Darmstadt, Germany) in FCS-free medium for 3 hours prior to treatment with HGF (10 ng/µl).
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Biophysics 2022Quote: Purified FHL was concentrated to 1-2 mg/mL using an Amicon centrifugal concentrator (100-kDa cutoff; Merck) and 3 µL of protein solution was applied to freshly glow-discharged C-flat 1.2/1.3 or 2/1 holey carbon grids (Protochips) ...
-
bioRxiv - Microbiology 2020Quote: ... Peptides were dissolved in 2% acetonitrile containing 0.1% trifluoroacetic acid and desalted using C18 ZipTips (Merck Millipore, Germany). Each sample was independently analysed on a Q-Exactive hybrid quadrupole-orbitrap mass spectrometer (Thermo Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Prior to sterilization pH of ASW was calibrated at 8.5 ± 0.5 through the addition of 2 M NaOH (Merck) solution ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL lipid extract was injected on a LiChroCART 250–4 LiChrospher® Si 60 (5 μm) (Merck) maintained at 25 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... and Click-iT® EdU (5-ethynyl-2’deoxyuridine) Assay (BCK-EDU488, baseclick GmbH, Merck/Sigma-Aldrich, UK), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... thawed pellet was resuspended into 20 ml lysis buffer (0.025 M Tris pH 8; 0.5 M NaCl; 2 mM MgCl2; 100 U/ml Benzonase (Merck); 0.25 mg/ml lysozyme (Roche) ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Cell Biology 2022Quote: ... cells pre-labeled with transferrin-Alexa Fluor 594 were treated for 2 hours with 10 μM SAR405 (Merck, cat ...
-
bioRxiv - Microbiology 2022Quote: ... concentrated to 2-10 mg/ml using Amicon concentration devices (Merck, 3,000 or 10,000 Da cut-off filter) and stored in aliquots at −80 °C until needed ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed three times in 0.1 M sodium cacodylate buffer pH 7.2 ± 0.1 containing 0.2 M sucrose and 2 mM MgCl2 (Merck Millipore), and adhered to 12 mm diameter round glass coverslips (Paul Marienfeld GmbH & Co ...
-
bioRxiv - Cell Biology 2022Quote: ... Pooled eluates were then concentrated approximately 40 times using a centrifugal filter (Amicon Ultra-2 10k, UFC201024, Merck Millipore ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... the mice were inoculated with 100,000 SB28-GFP cells suspended in 2 µl of DMEM (Merck, Darmstadt, Germany) (glioblastoma mice ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Microbiology 2023Quote: ... auris cells (CHRIST Alpha 1-2 LD plus lyophilizer, Osterode, Germany) using Tri Reagent (Merck Ltd. Budapest, Hungary). The quality of RNA was determined using the Eukaryotic Total RNA Nano kit (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were then induced for EmGFP-NSD3 expression with 2 μg/ml of doxycycline (D9891-1G, Merck) for 48 h ...
-
bioRxiv - Microbiology 2023Quote: ... A fraction of the inoculum was directly transferred into 2 ml tube containing TRI reagent (Sigma-Aldrich, Merck) and silica beads (0.1 mm diameter ...
-
bioRxiv - Biophysics 2023Quote: ... 5 and 10 μl of the lipid extract 2 cm from the bottom on aluminum-backed silica gel 60 TLC plates (cat#: 1.05553.0001; Merck) together with DOPG ...
-
bioRxiv - Molecular Biology 2022Quote: ... eggs rafts were hatched in trays containing 2 L of Milli-Q water (Synergy® UV, Merck, Germany). Larvae were fed continuously until the pupae stage with TetraMin® baby fish food (Tetra ...
-
bioRxiv - Molecular Biology 2023Quote: ... exponentially growing RPE-1 cells were pulse-labeled with 1 μM CldU (5-Chloro-2’-deoxyuridine, Merck, C6891) and 250 μM IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions were stopped with 2 µl of 0.5 M EDTA and separated using thin layer chromatography plates (Merck) with 0.3 M LiCl and 0.3 M formic acid as the mobile phase ...
-
bioRxiv - Biochemistry 2023Quote: The reaction mixtures (0.5, 1 or 2 µL) were spotted onto TLC Silica Gel 60 F254 plates (Merck). As for analysis of cyclization activity ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Human HepaRG hepatoma cells (1.5-2×105 cells/cm2, Biopredic International, Rennes, France) were cultured in William’s E medium (Merck) supplemented with 10% heat-inactivated FCS ...
-
bioRxiv - Zoology 2024Quote: ... The sample was then placed in 2 ml petroleum ether (boiling range 40-60°C, Merck, Darmstadt, Germany) at room temperature for two days ...
-
bioRxiv - Molecular Biology 2024Quote: ... The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck), respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... L-glutamine and antibiotic/antimycotics and decidualized with 1µM PGE2 or 1µM relaxin-2 (accession # P04090) (both Biotechne Ltd, Abbington, U.K.) in combination with 1µM medroxyprogesterone acetate (MPA) (Merck) for up to 4 days ...
-
bioRxiv - Cancer Biology 2024Quote: ... A total of 2 × 104 cells were cultured in an 8-well chamber slide (Merck Millipore, Massachusetts, USA) and then fixed with 4% paraformaldehyde in PBS buffer for 15 min at room temperature ...
-
bioRxiv - Physiology 2021Quote: ... For colocalization 1:100 anti-NBCe1 was incubated with 1:1,000 anti-Clara Cell Secretory Protein (CCSP; Merck Millipore cat#07-623) or 1:200 anti-alpha tubulin (Santa Cruz cat#sc-5286 ...
-
bioRxiv - Cell Biology 2023Quote: Anti-Cortactin (p80/85) clone 4F11 (ref. n°05-180-I) and Anti-LAMP1 (ref. n°L1418) are from Merck (Sigma-Aldrich). Alexa FluorTM 488 Phalloidin (ref ...
-
bioRxiv - Physiology 2024Quote: ... For colocalization 1:100 anti-CHRM3 was incubated with 1:500 anti-Clara Cell Secretory Protein (CCSP; Merck Millipore cat#07– 623), 1:200 anti-alpha tubulin (Santa Cruz ...
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Sections containing SN and VTA were incubated with antibodies directed against tyrosine hydroxylase (mouse monoclonal, 1:1000, Merck-Millipore MAB318) and mCherry (rabbit polyclonal ...
-
bioRxiv - Bioengineering 2020Quote: ... or mouse monoclonal β-actin antibody (1:1000 dilution; catalog no. catalog no. MAB 1501; Merck Millipore, Burlington, MA, USA) at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:10,000 WB) and mouse monoclonal antibody recognizing the N-terminus β-Actin (#A5441, 1:10,000 WB) were purchased from Merck. Rabbit polyclonal phosphomyosin (Thr18/Ser19 ...