Labshake search
Citations for Merck :
1551 - 1600 of 2089 citations for Mouse Anti Cholera Toxin Beta Subunit Antibody E10 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... slices were rinsed and incubated with secondary antibody (dilution 1:500; AP182C, Merck Millipore) diluted in 1% BSA TBST for 1-2h ...
-
bioRxiv - Biochemistry 2020Quote: ... Primary antibodies were used as follows: GST (1:1,000 dilution; Cat # 27457701V) from Merck, ubiquitin (1:1,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... Secondary antibody solutions were supplemented with 1 µg/mL DAPI solution (MBD0015; Merck KGaA) and 1 µg/mL BODIPY™ 493/503 dye (D3922 ...
-
bioRxiv - Microbiology 2022Quote: AB19026 ADAM10 rabbit polyclonal antibody (Immunogen: hADAM10 peptide 732-748) was purchased from Merck; anti-ADAM10 IC1427F was from R&D ...
-
bioRxiv - Genomics 2019Quote: ... The cells were incubated with an antibody against 8-oxoG (Merck KGaA, Darmstadt, Germany) diluted 1:200 in 0.05% Tween 20 in PBS for overnight at 4 °C ...
-
bioRxiv - Immunology 2020Quote: Antibody secreting cells (ASCs) were assayed in Multiscreen HA plates (Merck Milipore, Molsheim, France) coated with DT (10μg/mL) ...
-
bioRxiv - Microbiology 2022Quote: ... Antibodies were detected using the enhanced chemiluminescence system (Immobilon Forte Western HRP substrate, Merck) on the Amersham Imager 600 (GE Health Care Life Sciences) ...
-
bioRxiv - Neuroscience 2022Quote: ... and a polyclonal antibody against detyrosinated tubulin (1:1000; AB3201, Merck Millipore, Darmstadt, Germany) were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... with secondary antibodies diluted in blocking solution with 1% Hoechst 33258 (1:100, Merck). After three times washing with PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... the membranes were stripped using ReBlot Plus Mild Antibody Stripping Solution (Merck, Darmstadt, Germany), washed ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were stripped with 1X ReBlot Plus Strong Antibody Stripping Solution (#2504, Merck Millipore), blocked for 30 minutes in blocking milk ...
-
bioRxiv - Biophysics 2024Quote: ... the antibody was concentrated with an Amicon spin filter (MWCO 100 kDa, Merck, Germany) when the antibody concentration was below 2 mg/mL ...
-
bioRxiv - Physiology 2021Quote: ... For colocalization 1:100 anti-NBCe1 was incubated with 1:1,000 anti-Clara Cell Secretory Protein (CCSP; Merck Millipore cat#07-623) or 1:200 anti-alpha tubulin (Santa Cruz cat#sc-5286 ...
-
bioRxiv - Cell Biology 2023Quote: Anti-Cortactin (p80/85) clone 4F11 (ref. n°05-180-I) and Anti-LAMP1 (ref. n°L1418) are from Merck (Sigma-Aldrich). Alexa FluorTM 488 Phalloidin (ref ...
-
bioRxiv - Physiology 2024Quote: ... For colocalization 1:100 anti-CHRM3 was incubated with 1:500 anti-Clara Cell Secretory Protein (CCSP; Merck Millipore cat#07– 623), 1:200 anti-alpha tubulin (Santa Cruz ...
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse LL/2 (LLC1; ATCC no. CRL-1642; obtained in 2015) was grown in BME with Earle′s salts (Merck) with the same supplementation as mentioned above ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Cancer Biology 2023Quote: ... one mouse was exposed by drinking water to a mixture of BPA (1 µM, CAS no. 80-09-1, Merck) and DEHP (1 µM ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-NuMA1 clone AD6-1 (IF, WB) from Merck Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-Cux1 (1:100, ABE217; Merck Millipore). Nuclei were stained using Hoechst 33258 (Nacalai Tesque) ...
-
bioRxiv - Genomics 2020Quote: ... were washed in IP-buffer and incubated with 4 μg anti-AP-1 (Thermo Scientific™ #MA5-15172)or anti-Sp1 Ab (ChIPAb+™ Merck #17-601) for 1 h at 4 °C on a rotating wheel ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-H3.3 (Merck Millipore 09-838, 1:1000). A peroxidase-conjugated antibody was used to reveal the proteins of interest with the Pierce ECL Western blotting substrate (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2019Quote: ... or anti-dopa decarboxylase (1:500; AB1569; Merck Millipore), followed by 1-h incubation with secondary antibody goat anti-rabbit Alexa Fluor 680 (1:10,000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-phospho Histone H3 (1/500, 06-570, Merck), and anti-ZO-1 (1/50 ...
-
bioRxiv - Physiology 2021Quote: ... anti-Bcrp (1:100 – Bcrp [MAB4146]; Merck Millipore, USA), anti-Abcg1 (1:100 – [PA5-13462] ...
-
bioRxiv - Neuroscience 2020Quote: ... and rabbit anti-Tbr2 (1:1000, Merck Millipore, AB15894). Species-specific Cy2- ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were incubated with anti-Mena (Merck Millipore, #MAB2635) or anti-nesprin-2 (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... and goat anti-rat IgG HRP(1:5000; Merck); and goat anti-mouse IgG HRP (1:5000 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-c-terminal APP (1:1000, rabbit, A8717, Merck), anti-APP/Aβ (1:1000 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and anti-KLF17 (Sigma, HPA024629-100UL, Merck, Darmstadt, Germany), in PBS with 10% FBS addition ...
-
bioRxiv - Microbiology 2021Quote: ... or ANTI-Flag®M2 Affinity Gel (A2220, Merck) at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... with polyclonal goat anti-ChAT (AB144P; Merck; 1:150) and guinea pig anti-GnRH antibodies (#1018 ...
-
bioRxiv - Cell Biology 2020Quote: Anti-CD63 (CBL553, 1:1000) was acquired from Merck.
-
bioRxiv - Cancer Biology 2020Quote: ... using the anti-Puromycin (#MABE343; 1/5000) from Merck Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-GAPDH mab374 at 1/500 dilution (Merck); secondary #15014 at 1/10,000 (Active Motif).
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-MBP (1:300) (#MAB386, Merck-Millipore, Germany). After two washes in PBS ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... rabbit anti-Cep63 (Merck Millipore, MA, USA, 06-1292) at 1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... and probed for: RTN3 (rabbit polyclonal anti-RTN3; Merck Millipore #ABN1723 ...
-
bioRxiv - Biophysics 2021Quote: Rabbit polyclonal anti human IRSp53 (07-786 – Merck Millipore), mouse monoclonal anti CA (24.2 – NIH AIDS Reagent Program – FisherBioServices) ...
-
bioRxiv - Biophysics 2021Quote: ... rabbit polyclonal anti human IRSp53 (07-786 – Merck Millipore), mouse anti CA (183H125C – NIH3537) ...
-
bioRxiv - Neuroscience 2022Quote: ... polyclonal rat anti-dopamine transporter (MAB369, Merck (Sigma-Aldrich); 1:1000).
-
bioRxiv - Neuroscience 2022Quote: ... anti-GluR2 (1:2000, AB1768-I, Merck, Darmstadt, Germany) and anti-β-Actin (1:5000 ...
-
bioRxiv - Genetics 2021Quote: ... spectrin (Anti-spectrin MAB1622 Merck Millipore, Burlington, MA, USA), ubiquitinated proteins (Anti-ubiquitin ab134953 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-phospho-Histone H3 (Ser10) (Merck-Millipore, #06-570), anti-GFP (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-EZH2 (1:500 each) (Merck Millipore, Darmstadt, Germany), and anti-GAPDH (1:5000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-pH3 (Merck Millipore #06-570; 1:1000), rabbit monoclonal anti-pMad (Abcam #ab52903 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-von Willebrand Factor (vWF - Merck F3520, 1:200). Secondary antibodies (Alexa 488- ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-MITF (1/100, clone C5, MAB3747, Merck-millipore), anti-HNK1 (1/50 ...
-
bioRxiv - Microbiology 2022Quote: ... rabbit anti-ubiquitin Lys-63-specific (#05-1308, Merck), rabbit anti-ubiquitin Lys-48-specific (#05-1307 ...