Labshake search
Citations for Merck :
1551 - 1600 of 2822 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... washed four times with PBS and permeabilized for 5 min with 0,5% Triton X-100 (Merck) in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were spotted on a 5 x 10 cm TLC silica gel 60 F254 (Merck) and developed in petroleum ether:diethyl ether (9:1) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 50 μL magnetic beads were incubated with 5 μg of Ago-1 antibody (Merck, Millipore, Germany) or IgG antibody (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... reduced with 5 mM TCEP for 30 min and alkylated with 10 mM iodoacetamide (Merck, I1149) for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µm) coupled with a SeQuant® ZIC®-pHILIC Guard (20 mm × 2.1 mm) (Merck) was used for analyte separation ...
-
bioRxiv - Neuroscience 2022Quote: ... Chromatographic separation was performed on a Sequant ZIC-pHILIC column (5 μm, 2.1 × 150 mm; Merck) maintained at 45°C ...
-
bioRxiv - Microbiology 2022Quote: ... 50 and 70% for 5 min and 95% and 100% twice for 10 min (Merck Millipore). The coverslips were then critical-point-dried using an EM DPC 300 critical point drier (Leica ...
-
bioRxiv - Cell Biology 2023Quote: ... Preparations were thereafter fixed with 100% methanol for 15 s and stained with 5% Giemsa (Merck) for 15 minutes ...
-
bioRxiv - Immunology 2023Quote: Resuspended HLA-I-eluted samples were centrifuged through 5 kDa cutoff filters (Merck Millipore #UFC3LCCNB-HMT) and vacuum-dried ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 % Natural Goat Serum (Goat serum from controlled donor herd, G6767-100ML, Sigma Aldrich, Merck, Germany) and primary antibodies (see Table 3 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... For removal of chorion embryos were incubated for 5 mins with 1 mg/ml Pronase (Merck) then washed with culture medium and flash-frozen in liquid nitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were treated with 10 μM DAPT and 5 μM Cytarabine (ARA-C) (Merck, Cat#C3350000) for 24 hours ...
-
bioRxiv - Cell Biology 2023Quote: Oocytes were cultured in G-IVF PLUS (Vitrolife, #10136) under mineral oil (Merck, # 8042-47-5) at 37°C in 5% O2 ...
-
bioRxiv - Biophysics 2023Quote: ... adult male Wistar rats aged ∼ 5 weeks were given an intraperitoneal injection of crotaline (Merck, NJ) to induce pulmonary arterial hypertension ...
-
bioRxiv - Cell Biology 2022Quote: ... a SeQuant ZIC-pHILIC (100 mm, 2.1 mm I.D. and 5 μm particle size, Merck, Germany) column was used ...
-
bioRxiv - Cancer Biology 2022Quote: ... For final and irreversible sample dehydration a graded serie (25%, 50%, 75% and 100%, 5 min each) of 1,1,1,3,3,3-hexamethyldizilazane (HDMS, Merck, Millipore) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... Parasitemia was maintained below 5% and determined via Hemacolor staining of blood smears (Sigma-Aldrich, Merck) using a Nikon Eclipse E100 microscope (Nikon Corporation ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Genetics 2024Quote: ... Membranes were blocked for a minimum of 30 min in 5% Skim Milk Powder (Merck, #70166) in PBS + 0.1% Tween-20 (PBS-T ...
-
bioRxiv - Immunology 2024Quote: ... slides were rinsed in double-distilled water and counterstained with Hoechst dye (5 μg/mL; Merck). Stained slides were subsequently imaged using an LSM700 confocal microscope (Zeiss).
-
bioRxiv - Microbiology 2024Quote: ... the bacterial isolates were cultured overnight in 5 mL of sterile Muller-Hinton broth (Merck, Germany) at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Genomics 2024Quote: ... Coverslips were re-calibrated in PBST (PBS with 0,2% Tween 20 Merck, Cat 9005-64-5) for 5 minutes and 50ul of primary antibody (rabbit anti-BRD4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... animals were transferred to 10 cm NGM agar plates containing 5-FU (10 µM) (Merck, #F6627) to prevent progeny production ...
-
bioRxiv - Molecular Biology 2024Quote: ... animals were transferred to 10 cm NGM agar plates containing 5-FU (10 µM) (Merck, #F6627) to prevent progeny production ...
-
bioRxiv - Neuroscience 2024Quote: ... neurons were permeabilized and blocked with PBS containing 0.1% Triton X (#9005-64-5, Merck, Germany), 5% ...
-
bioRxiv - Biochemistry 2024Quote: ... the spacer region between them and flanking regions of 5 bp were ordered from Merck (Germany). The 5’ end of sense strand of each oligonucleotide was labeled with Cyanine 5 dye (Cy5 ...
-
bioRxiv - Bioengineering 2024Quote: ... and 5 mg ml-1 fibrinogen from bovine plasma type I-S (Merck KGaA, Darmstadt, Germany); then ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by 5 min in a 1:1 mixture of propylene oxide (Fluka, Merck, Darmstadt, Germany) and SPURR (Low Viscosity Spurr Kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... Females were stimulated with 5 IU of pregnant mare serum gonadotropin (PMSG; Folligon; Merck Animal Health) per mouse 46 hours prior to oocyte isolation ...
-
bioRxiv - Cell Biology 2020Quote: ... pDEST15 plasmids were transformed in Rosetta™ 2(DE3)pLysS Competent bacteria (Merck Millipore). Bacteria cultures were grown with the proper antibiotic at 37°C until an OD of 0.6 was obtained ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies used were CYFIP1/2 (Sra-1/PIR121 [14], Rac1/3 (23A8, Merck), Nap1 [14] ...
-
bioRxiv - Microbiology 2021Quote: ... Freeze substitution was done in dry acetone containing 2% osmium tetroxide (Merck, Darmstadt, Germany) and 2% water with an AFS (Leica microsystems ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was loaded on a 2 ml HIS-SelectTM Nickel Affinity Gel (Merck) and washed with wash buffer ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was loaded on a 2 ml HIS-SelectTM Nickel Affinity Gel (Merck) and washed with wash buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... concentrated using 100 kDa-MWCO Centricon plus-20 and Centricon plus-2 (Merck-Millipore), aliquoted and stored at -80 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mM EDTA and 200 μg/ml PMSF) supplemented with protease inhibitors (Merck Chemicals) and centrifuged at 800x g for 10 min at 4°C to result in P1 and supernatant S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Anti-human Aβ mouse monoclonal antibody (clone W0-2; Merck Chemicals GmbH, Darmstadt, Germany) and rabbit anti-β-actin monoclonal antibody (clone 13E5 ...
-
bioRxiv - Neuroscience 2021Quote: ... and lysed directly in 15 µl 2x Laemmli buffer containing 10% 2-mercaptoethanol (Merck). Samples were loaded on a 4-to-20% SDS polyacrylamide gel (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... Differentiation of 4D7 and 2M12 cells was induced by 2% dimethyl sulfoxide (DMSO; Merck) for 48 hr ...
-
bioRxiv - Cell Biology 2021Quote: ... and after 24 h the transformants were selected with 2 μg/mL puromycin (Merck) for 24–48h.
-
bioRxiv - Microbiology 2021Quote: ... 2 mM β-mercaptoethanol) supplemented with a protease-inhibitor cocktail (cOmplete, Sigma-Aldrich/Merck) and stored at 193 K ...
-
bioRxiv - Developmental Biology 2022Quote: ... (2) we added 50 µg/mL (0.28 collagenase Wünsch units) of Liberase TM (Merck) in the digestion solution ...
-
bioRxiv - Developmental Biology 2020Quote: ... mice were injected intraperitoneally with a filter sterilized solution of 2 mg doxycycline (Merck), dissolved in PBS (100 μl or 200 μl of a filter sterilized ...
-
bioRxiv - Microbiology 2021Quote: ... in 2 ml tubes containing 0.3 mm diameter glass beads (Merck KGaA, Darmstadt, Germany). The mixture was vortexed ...
-
bioRxiv - Biochemistry 2021Quote: Transformation of Escherichia coli strain BL21(DE3) Rosetta-2 pLysS (Novagen Merck, Darmstadt Germany) were made with a pET3d-His6-CrFBA3 plasmid ...
-
bioRxiv - Physiology 2021Quote: ... a grid was briefly placed on 10 μL 2% uranyl acetate (w/v, Merck). Images were acquired under a JEM-1010 electron microscope (JEOL ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was done using 2 ng of DNA and KOD hot star (MercK). PCR fragments were sequenced by EurofinsGenomics ...
-
bioRxiv - Biochemistry 2023Quote: ... 100mM NaCl using 3k cut-off Amicon® Ultra 2 mL Centrifugal Filters (Merck). Equal amounts of protein from both dialyzed and undialyzed samples were treated with caspase-3 as described above ...
-
bioRxiv - Plant Biology 2023Quote: ... then 2% w/v Aspegillus niger pectinase (Merck Life Science UK Ltd., Gillingham, UK) 45°C for 2 hours ...