Labshake search
Citations for Merck :
1551 - 1600 of 2466 citations for 5 2 Chloronicotinoyl 2 furoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The resulting ultrafiltrate (15min 14000g 15°C) was acidified with 20 µl 4% formic acid (Merck) in dH2O ...
-
bioRxiv - Neuroscience 2021Quote: Commercial pectin derived from citrus peels (galacturonic acid, ≥74.0%, dried basis, Sigma-Aldrich, Merck, Darmstadt, Germany), labelled “Citrus” in Figures ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... in absolute ethanol (Thermo-Fischer; order code AJA214-2.5LPL) and 3 mL of propionic acid (Merck, Pty Ltd. ...
-
bioRxiv - Bioengineering 2022Quote: ... the sections were rinsed in 0.1% acidified water and 0.5% acidified water (Acetic acid, Merck, 1.00056.2500) each for 1 minutes ...
-
bioRxiv - Immunology 2023Quote: ... Bacterial cells processed via ultrasound and insoluble inclusion bodies were extracted with 1% deoxycholic acid (Merck) and 1% Triton X-100 (Merck ...
-
bioRxiv - Pathology 2023Quote: ... the ECM samples were treated with 0.18 % peracetic acid solution (32% w/w; Merck, Darmstadt, Germany) in 4.8% ethanol (Fresenius Kabi ...
-
bioRxiv - Cell Biology 2023Quote: ... and an equal number of cells were digested in 100 μl of Nitric acid (Merck #1.00441.1000) overnight at 95°C ...
-
bioRxiv - Plant Biology 2023Quote: ... AIR was extracted sequentially first with 50 mM CDTA (1,2-Cyclohexylenedinitrilotetraacetic Acid) (CDTA; Merck Darmstadt, Germany) followed by 4 M NaOH ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... washed twice with 95% ethanol and resuspended in acetate buffer (0.84% sodium acetate, 0.46% acetic acid, pH 4.75) containing 0.3mg/mL amyloglucosidase (Merck). Glycogen was digested overnight at 37°C before glucose content was quantified using the glucose oxidase method15 and 14C-glucose incorporation was measured ...
-
bioRxiv - Bioengineering 2024Quote: ... the gelatin was first removed from the solution by precipitating it with trichloroacetic acid (Merck, T4885). The content of sodium was calculated using a calibration curve made by measuring dilutions of a standard sodium solution (Merck ...
-
bioRxiv - Physiology 2024Quote: ... followed by 1% acetic acid for 30 seconds and Safranin’O solution for 45 min (S2255, Merck).
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Plant Biology 2024Quote: ... The extracts were spotted on a 5 cm x 5 cm TLC Silica gel 60 F₂₅₄ plate (Merck, Darmstadt, Germany). The blots were stained by spraying with a methanolic solution including 1% diphenylboric acid 2- aminoethylester (DPBA ...
-
bioRxiv - Genetics 2024Quote: ... 90%, 100% ethanol, 5 min each), cleared in xylene (twice, 5 min each) and mounted with DPX mounting medium (Merck).
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... using spin filters (Merck, Millipore, MWCO: 5 kDa).
-
bioRxiv - Neuroscience 2020Quote: ... 5% aluminum sulfate solution (Merck Millipore, ref. 1.00121) for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% BSA (Merck KGaA) in TBS (Merck KGaA ...
-
bioRxiv - Biochemistry 2020Quote: ... Slides were later stained with 5% Giemsa (Merck) for 4 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with benzonase (5 μL/g pellet, Merck) and incubated for 15 min on a shaking table ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were suspended in 5% BSA (Merck; #12659) in PBS and single cells were sorted using a BD FACSJazz system into wells of a 96-well cell culture plate ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescein-labelled ssDNA substrate (5’[FAM]-pT50; Merck) was used in all SEC experiments to allow us to characterise complexes formed on DNA in the absence of any unwinding.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 % heat-inactivated horse serum (Merck), EGF (20 ng mL−1 ...
-
bioRxiv - Biochemistry 2024Quote: ... Blocking with 5% bovine serum albumin (Merck, 126575) was used for rabbit anti-LC3B-I/II (1:3000 ...
-
bioRxiv - Systems Biology 2024Quote: ... (5) Pronase (Merck, CAS-No 9036-06-0) at a concentration of 1:100 in E3 1x medium is added at 20 hpf to remove the chorion [83] ...
-
bioRxiv - Cancer Biology 2024Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). At least 3 independent experiments with at least 2 independent littermate MEF clones of each genotype and each sex were performed to measure DNA damage responses ...
-
bioRxiv - Plant Biology 2020Quote: Inflorescences were harvested into fresh fixative (3:1 96% [v/v] ethanol [Merck] and glacial acetic acid) and kept overnight (O/N ...
-
bioRxiv - Cell Biology 2022Quote: ... Lipid extracts were pooled and an aliquot of samples and standard mix (triolein:diolein:monoolein:oleic acid) were applied to a silica 60 thin-layer chromatography plate (1.05553.0001, Merck, Darmstadt, Germany) using hexane:diethylether:acetic acid (70:29:1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and functionalized by 200 µl of a 3% (v/v) solution of hyaluronic acid (HA) (Merck, Germany) at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mobile phase consisted of (A) 0.1% formic acid in MQ H2O (Merck Millipore, Bedford, MA, USA) and (B ...