Labshake search
Citations for Merck :
1451 - 1500 of 1660 citations for Recombinant Mouse EFNB2 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by washing and staining with horseradish peroxidase-conjugated donkey anti-rabbit or anti-mouse IgG secondary antibodies (1:5,000 dilution; Merck Millipore), respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... AB5543), chicken anti-β3 tubulin (1:500, AB9354) and mouse anti-ankyrin G (1:500, MABN466) were purchased from Merck Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000, Merck Millipore ...
-
bioRxiv - Genetics 2021Quote: ... a mouse anti-glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody (#MAB374, used at 1:10,000 for the Western blot analyses, Merck Millipore); a rabbit anti-LC3B polyclonal antibody (#2775 ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following antibodies were used for ChIP analysis: Mouse anti-RNA polymerase II antibody clone CTD4H8 (Merck Millipore, 05-623), Rabbit anti-NF-kB p65 antibody clone D14E12 (Cell Signalling ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were run on SDS-PAGE and the expression of IDO1 was analyzed with a mouse anti-IDO1 antibody (clone 8G-11, Merck). Mouse monoclonal Ab against β-tubulin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation with a rabbit anti-Kv4.3 primary antibody (1:10000, Alomone Labs) together with chicken (G)/mouse (L) anti-TH primary antibody (1:1000, Abcam / Merck) in a carrier solution (1% NGS ...
-
bioRxiv - Cell Biology 2023Quote: Proximity ligation assays with Aurora A kinase and MP-GAP were performed in HeLa cells using mouse anti-Aurora A Kinase antibody (1:500, A1231 Merck), rabbit anti-MP-GAP antibody (1:250 ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... the fixation procedure above with and without subsequent membrane permeabilization was used in infected/uninfected organoids that were then stained with a mouse monoclonal anti-mitochondria antibody Cy3 conjugate (Merck) incubated overnight at 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... Then these samples were incubated in Alexa Fluor 488 conjugated mouse monoclonal anti-CTSK antibody (1:100) at 4°C overnight (Merck) and then for 1h under agitation at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated overnight with an anti-GFP rabbit antibody (0.5 μg/ml) (Tamamaki et al., 2000) and an anti-Cre recombinase mouse monoclonal antibody (1:1,000; MAB3120, Merck Millipore). After a rinse ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:10,000 WB) and mouse monoclonal antibody recognizing the N-terminus β-Actin (#A5441, 1:10,000 WB) were purchased from Merck. Rabbit polyclonal phosphomyosin (Thr18/Ser19 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... CDK9 was immunoprecipitated with 15μg of an anti-CDK9 antibody (D-7, sc-13130, lot no # B1422) or control mouse IgG (12-371, Merck) in IP Buffer with 2X SDS buffer (100mM NaCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... one mouse was exposed by drinking water to a mixture of BPA (1 µM, CAS no. 80-09-1, Merck) and DEHP (1 µM ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were incubated with secondary antibodies conjugated with PLA probes MINUS and PLUS: the PLA probe anti-mouse PLUS and anti-rabbit MINUS (Merck). Incubation with all antibodies was accomplished in a humidified chamber for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... Stag-Tulp3 was then pulled down from the TEV digestion eluates by overnight 4°C rotational incubation using S-protein agarose beads (Merck, #69704). Beads were then eluted with Laemmli buffer and processed for SDS-PAGE in Novex Value 4-20% Tris-Glycine gels (Thermofisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... From the remaining nuclei RNA-IP was then undertaken with the MagnaRIP Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit protocol (17-700, Merck) from step I.3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... immunofluorescence staining was performed using overnight incubation with polyclonal anti-Prosurfactant Protein C (ProSP-C) (Merck/Millipore/Sigma Aldrich, 1:500) followed by staining with polyclonal secondary antibody Goat anti-rabbit Alexa fluor 488 (Invitrogen,1:500) ...
-
bioRxiv - Cancer Biology 2020Quote: CAF CMed was also separated into the metabolite (less than 3kDa) and protein (more than 3kDa) fractions using 3kDa centrifugal filters (Merck Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Proteins were detected by incubation with primary antibodies (SOX2, Bio-techne, AF2018, 1: 1000 and α-Tubulin, Merck, T6199, 1:2000) and secondary antibodies (Donkey anti-Goat IRDye® 800CW ...
-
bioRxiv - Bioengineering 2021Quote: ... and GEES protein fractions (2-16 µg) were processed by the MED-FASP protocol using Microcon 30k centrifugal ultrafiltration units (Merck, Darmstadt) [11] ...
-
bioRxiv - Molecular Biology 2020Quote: ... The purity of the proteins were asses by SDS-PAGE and the fractions were pooled pure and concentrated using an Amicon Ultra concentrator (Merck Millipore) with a 10 KDa cut-off ...
-
bioRxiv - Neuroscience 2020Quote: ... The proteins were transferred to a low fluorescent polyvinylidene difluoride membrane Immobilon-FL (0.45 μm pore size; Merck-Millipore, Czech Republic) by a Mini Trans-Blot® cell system (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Samples of the eluted fractions were loaded into 15% SDS-PAGE gels and the fractions containing the nucleocapsid protein were concentrated using Amicon Ultra-15 concentric filters (Merck Millipore) with a 10 kDa cutoff ...
-
bioRxiv - Neuroscience 2021Quote: ... Equal amounts of 20 to 30 μg of protein were separated by SDS-PAGE and transferred onto PVDF membranes (Immobilion-P, Merck Millipore) according to standard protocols ...
-
bioRxiv - Cell Biology 2020Quote: ... To change the buffer in the M- and Z-AAT protein pools to Hank’s balanced salt solution (HBSS, Merck, Darmstadt, Germany) we used Vivaspin centrifugal concentrators with 10,000 MWCO (Vivaproducts ...
-
bioRxiv - Systems Biology 2022Quote: ... The proteins were washed twice with acetone and subsequently solubilized using 100 mM ammonium bicarbonate (ABC) (Merck Sigma, Cat. No. 09830). Alternatively ...
-
bioRxiv - Biochemistry 2022Quote: ... The His6- tagged proteins were purified using Immobilised Metal Affinity Chromatography (IMAC) with 2mL Ni-NTA His•Bind® Resin (Merck), followed by incubation with TEV protease for 12 hours at 4 °C to remove the His6 tag ...
-
bioRxiv - Biochemistry 2022Quote: ... were separated on 0.1% SDS polyacrylamide gels (6–12% w/v depending on the molecular mass of protein) and electroblotted onto Immobilon-PVDF Transfer Membrane (Merck Millipore). Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin ...
-
bioRxiv - Microbiology 2020Quote: ... The collected supernatant was kept on ice until measurements of protein concentrations using Direct Detect® Spectrometer (Merck Millipore, Darmstadt, Germany).
-
bioRxiv - Microbiology 2022Quote: ... Proteins in cell lysates were separated by 10% SDS-PAGE and transferred to Immobilon NC membranes (Millipore Merck KGaA, Darmstadt, Germany). The membranes were blocked by incubation with 5% nonfat dry milk in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... were expressed as fusion proteins with 6x polyHis tail at the C-terminus in E.coli strain BL21(DE3) (Merck-Novagen, Darmstadt). After harvesting ...
-
bioRxiv - Biochemistry 2019Quote: ... Fractions containing the desired His6-tagged protein were concentrated to 2 ml using Amicon® Ultra Centrifugal Filters (10,000 MWCO, Merck Millipore), and were directly injected into a size-exclusion chromatography column (Superdex 75 16/60 ...
-
bioRxiv - Biochemistry 2020Quote: ... epithelium suspension cell line expressing the EBNA-1 protein (female origin) was cultured in EX-CELL(r) 293 Serum-Free Medium (Merck, 14571C) containing 4 mM GlutaMAX supplement (TermoFisher ...
-
A bacterial signal transduction phosphorelay in the methanogenic archaeon Methanosarcina acetivoransbioRxiv - Microbiology 2021Quote: ... and concentrated using Amicon concentrator devices (molecular weight cut-off, 10 000 and for full-length protein 50 000; Merck Millipore). Recombinant His-tagged proteins (MA4376 ...
-
bioRxiv - Microbiology 2020Quote: Recombinant full length SIC proteins were purified using affinity chromatography with a His-bind column as per manufacturer’s instructions (Novagen, Merck, Darmstadt, Germany). sic1.300 ...
-
Bacterial killing by complement requires direct anchoring of Membrane Attack Complex precursor C5b-7bioRxiv - Immunology 2019Quote: ... GGG-azide labelled proteins were washed with Tris/NaCl buffer and concentrated to 25 µM on a 30 kDa Amicon Tube (Merck Millipore) and afterwards labelled with 100 µM DBCO-Cy5 (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2022Quote: The m6A enrichment experiment was performed as described previously with minor modifications (Dominissini et al., 2013) and the Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Merck) was used following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: ... and separating gel were used for SDS-PAGE and as a molecular weight standard protein marker (97, 66, 43, 29, 20, 14kDa) (Merck, India) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... the remainder was pre-cleared by co-incubation with 40 µL of PureProteome Protein A/G magnetic beads (Merck Millipore, LSKMAGAG10) per sample and rotation for 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell extracts of equal total protein (20 μg each) were separated by SDS-PAGE and transferred to Nylon membrane (Merck Millipore). The membranes were blocked with 5% nonfat milk in TBST washing buffer (10 mM Tris pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... Fractions containing the protein of interest were pooled and concentrated using an Amicon® Ultra-4 3K centrifugal filter unit (Merck) according to the manufacturer’s recommendation ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were separated by SDS-PAGE and were blotted onto an Amersham™ Protran® nitrocellulose membrane (Merck KGaA; Darmstadt, Germany) for 1.5 h using const ...
-
bioRxiv - Microbiology 2023Quote: ... the membranes were washed three times with TBST for 10 min and proteins were detected via chemiluminescence using Immobilon® Forte Western HRP substrate (Merck). For the multiplex detection of native LpxC and the LPS level 12% stain-free FastCast Acrylamide gels (BioRad ...
-
bioRxiv - Neuroscience 2023Quote: ... or human post-mortem total protein/ synaptoneurosome samples were then mixed into equal volumes of 2X Laemmli buffer (Merck: S3401- 10VL) and boiled for 10 minutes at 98 °C ...