Labshake search
Citations for Merck :
1451 - 1500 of 1933 citations for Mouse Serine threonine Protein Kinase 17B STK17B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and transiently transfected with the plasmid DNA containing GFP-tagged protein of interest (See Table S7 for plasmid constructs) using GeneJuice transfection reagent (70967, Merck) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Immunoprecipitation of cell lysates overexpressing FLAG-tagged or GST-tagged proteins were performed using anti-FLAG-M2 affinity beads (Merck) or glutathione-Sepharose beads (Cytiva).
-
bioRxiv - Biophysics 2023Quote: ... The lysozyme protein solution was filtered by a 0.22 μm hydrophilic polyethersulfone (PES) membrane filter (Cat#SLGP033NS, Merck Millipore, USA). The filtered sample was stored in 1.0 mL aliquots at −45 °C until crystallization experiments were performed ...
-
bioRxiv - Biochemistry 2023Quote: ... Fractions were analyzed by SDS-PAGE and those containing the target protein were pooled and concentrated with Amicon Ultra Centrifugal Filter Units 10K MWCO (Merck). GbpA was further purified by SEC using a Superdex 200 Increase 30/100 GL column (Cytiva ...
-
bioRxiv - Plant Biology 2023Quote: ... alkylation and tryptic digestion (50 µg of protein per sample) was performed in centrifugal filters (Amicon Ultra-0.5, 30 kDa cut-off, Merck Millipore) according to the FASP protocol (Wiśniewski et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... The amount of puromycin incorporated into nascent peptides was then evaluated by Western blot analysis on 20 μg of proteins using anti-puromycin antibody (ref MABE343) purchased from Merck Millipore (Darmstadt ...
-
bioRxiv - Neuroscience 2024Quote: ... and equal amount of protein were separated by SDS-PAGE and transferred to polyvinylidene difluoride membranes (Immobilon-P, Merck Millipore). Membranes were blocked for one hour in I-BlockTM (# T2015 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 500 μg of chimeric InvP protein in-solution and mixing with an equivalent volume of Freund’s complete adjuvant (Merck F5881). For the subsequent five booster doses ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitations were performed as previously described7 using Protein G Dynabeads (LifeTechnologies) coupled to Myc 4A6 antibody (Merck Millipore, 05-724) or FLAG M2 monoclonal antibody (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... Affinity-purified recombinant TrK13 proteins (WT, C580Y, R539T and C580Y) or commercially purchased BSA (A7030) or lysozyme (L6876) (Merck, Germany), each at 10 µM concentration ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were lysed in a protein extraction solution (∼10 µL/ mg tissue) consisting of 0.32M sucrose with protease inhibitors (Merck #4693159001) and phosphatase inhibitors (Pierce # A32957 ...
-
bioRxiv - Plant Biology 2024Quote: ... the purified protein was concentrated by centrifugation in 3 kDa cut-off filters (Amicon Ultra-15 Centrifugal Filter Units, Merck) at 4,500 x g ...
-
bioRxiv - Plant Biology 2024Quote: ... The purified protein was concentrated by centrifugation in 3 kDa cut-off filters (Amicon Ultra-15 Centrifugal Filter Units, Merck) at 4500 × g ...
-
bioRxiv - Plant Biology 2024Quote: ... Apoenzyme preparations of D-AAT and AtPLPHP1 were achieved by incubating 100 μM of purified protein with 75 mM D-cycloserine (Merck) in 50 mM HEPES pH 7.4 containing 300 mM sodium chloride on ice for 2 hours followed by buffer exchange as described above ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein concentration was quantified and 100ug proteins of each sample were incubated in acetonitrile with Sera-Mag SpeedBead Carboxylate-Modified Magnetic Particles (Hydrophilic) (#GE44152105050250, Merck) and Sera-Mag SpeedBead Carboxylate-Modified Magnetic Particles (Hydrophobic ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins in the lysate were then fractionated by SDS-PAGE and transferred to a PVDF membrane (Merck Millipore, Cat#IPVH00010). After blocking with 1% nonfat milk overnight at 4°C ...
-
bioRxiv - Plant Biology 2024Quote: ... the purified protein was concentrated by centrifugation in 3 kDa cut-off filters (Amicon Ultra-15 Centrifugal Filter Units, Merck) at 4,500 x g ...
-
bioRxiv - Biophysics 2024Quote: ... The protein was concentrated to 60 µM – 100 µM using an Amicon Ultra Centrifugal Filter Unit (30 kDa MWCO, Merck) and stored at −80 °C.
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with FITC (Fluorescein isothiocyanate) conjugated secondary antibody (0.5 μg/ml of Goat Anti-Mouse IgG-FITC in 5%BSA) (GeNei, Merck, USA) (Cat.no ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary antibodies were detected with HRP-conjugated anti-rabbit or anti-mouse IgG and visualised with Immobilon Western HRP substrate (Merck).
-
bioRxiv - Immunology 2021Quote: ... or 1 × 105 BM-DCs (mouse) per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed once and then incubated with the appropriate fluorescently labelled secondary antibody (anti-mouse polyvalent Ig-FITC (Merck) or anti-His6 HIS.H8 DyLight 488 ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibodies, anti-rabbit IgG-HRP (1:5000, #7074, CST) or anti-mouse-HRP (1:10000, #12-349, Merck Millipore) in TBST containing 5% milk for 1 h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at room temperature in darkness with the primary antibody solution containing mouse anti-vesicular Glutamate Transporter 1 (vGLUT1, 1:1000, MAB5502, Merck) or rabbit anti-Glutamate Decarboxylase 65-67 (GAD 65-67 ...
-
bioRxiv - Neuroscience 2020Quote: ... The blots were blocked in PBS/ 0,05%Tween20 containing 5% skim milk and then probed with the following primary antibodies over night at 4°C: mouse anti-P53 (1:100, Merck), rabbit anti-H2AX (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... blocked with 10% bovine serum albumin (BSA) 30 min at 37°C and incubated with primary anti-γH2A.X mouse antibodies (Merck Millipore) or rabbit anti-LC3B antibodies (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse LL/2 (LLC1; ATCC no. CRL-1642; obtained in 2015) was grown in BME with Earle′s salts (Merck) with the same supplementation as mentioned above ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Sections containing SN and VTA were incubated with antibodies directed against tyrosine hydroxylase (mouse monoclonal, 1:1000, Merck-Millipore MAB318) and mCherry (rabbit polyclonal ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at room temperature in darkness with the primary antibody solution containing mouse anti-vesicular Glutamate Transporter 1 (vGlut1, 1:1000, MAB5502, Merck) and rabbit anti-Glutamate Decarboxylase 65-67 (GAD 65-67 ...
-
bioRxiv - Cell Biology 2022Quote: ... and SDS-PAGE and immunoblots were performed by standard methods using a mouse monoclonal anti-MYC antibody (clone 4A6, 05-724, Merck).
-
bioRxiv - Bioengineering 2020Quote: ... or mouse monoclonal β-actin antibody (1:1000 dilution; catalog no. catalog no. MAB 1501; Merck Millipore, Burlington, MA, USA) at room temperature for 1 hour ...
-
bioRxiv - Bioengineering 2019Quote: ... Tween 20 with 3 % (w/v) skim milk powder and successively incubated with monoclonal mouse anti-T7 RNA polymerase antibodies (Novagen, Merck) and POD labelled goat anti-mouse antibodies (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by washing and staining with horseradish peroxidase-conjugated donkey anti-rabbit or anti-mouse IgG secondary antibodies (1:5,000 dilution; Merck Millipore), respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... AB5543), chicken anti-β3 tubulin (1:500, AB9354) and mouse anti-ankyrin G (1:500, MABN466) were purchased from Merck Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000, Merck Millipore ...
-
bioRxiv - Genetics 2021Quote: ... a mouse anti-glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody (#MAB374, used at 1:10,000 for the Western blot analyses, Merck Millipore); a rabbit anti-LC3B polyclonal antibody (#2775 ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The following antibodies were used for ChIP analysis: Mouse anti-RNA polymerase II antibody clone CTD4H8 (Merck Millipore, 05-623), Rabbit anti-NF-kB p65 antibody clone D14E12 (Cell Signalling ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were run on SDS-PAGE and the expression of IDO1 was analyzed with a mouse anti-IDO1 antibody (clone 8G-11, Merck). Mouse monoclonal Ab against β-tubulin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... the fixation procedure above with and without subsequent membrane permeabilization was used in infected/uninfected organoids that were then stained with a mouse monoclonal anti-mitochondria antibody Cy3 conjugate (Merck) incubated overnight at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation with a rabbit anti-Kv4.3 primary antibody (1:10000, Alomone Labs) together with chicken (G)/mouse (L) anti-TH primary antibody (1:1000, Abcam / Merck) in a carrier solution (1% NGS ...
-
bioRxiv - Bioengineering 2023Quote: ... Then these samples were incubated in Alexa Fluor 488 conjugated mouse monoclonal anti-CTSK antibody (1:100) at 4°C overnight (Merck) and then for 1h under agitation at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated overnight with an anti-GFP rabbit antibody (0.5 μg/ml) (Tamamaki et al., 2000) and an anti-Cre recombinase mouse monoclonal antibody (1:1,000; MAB3120, Merck Millipore). After a rinse ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... CDK9 was immunoprecipitated with 15μg of an anti-CDK9 antibody (D-7, sc-13130, lot no # B1422) or control mouse IgG (12-371, Merck) in IP Buffer with 2X SDS buffer (100mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:10,000 WB) and mouse monoclonal antibody recognizing the N-terminus β-Actin (#A5441, 1:10,000 WB) were purchased from Merck. Rabbit polyclonal phosphomyosin (Thr18/Ser19 ...
-
bioRxiv - Cancer Biology 2023Quote: ... one mouse was exposed by drinking water to a mixture of BPA (1 µM, CAS no. 80-09-1, Merck) and DEHP (1 µM ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were incubated with secondary antibodies conjugated with PLA probes MINUS and PLUS: the PLA probe anti-mouse PLUS and anti-rabbit MINUS (Merck). Incubation with all antibodies was accomplished in a humidified chamber for 1 h at 37 °C ...