Labshake search
Citations for Merck :
101 - 150 of 1237 citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mg/ml collagenase P (Merck), 1 mg/ml collagenase B (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3% Normal donkey serum (NDS, Merck), 2%BSA (NACALAI TESQUE) ...
-
bioRxiv - Neuroscience 2024Quote: ... and pyridine (Merck, Germany, 9:3:1) in a GC vial for GC–mass selective detector non-cholesterol and oxysterol analysis ...
-
bioRxiv - Microbiology 2024Quote: ... and 3% Normal Goat Serum (Merck, S26)) for 1h at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 µM IWR-1 (I0161, Merck) with 20 µM Y27632 ...
-
bioRxiv - Microbiology 2021Quote: Peptides EcFtsN1-32-C and VmFtsN1-29-C were labelled with maleimide-Atto 495 (Merck Life Science UK). EcFtsA1-405 and VmFtsA1-396 were buffer exchanged into binding buffer (50 mM HEPES/KOH ...
-
bioRxiv - Microbiology 2021Quote: Peptides EcFtsN1-32-C and VmFtsN1-29-C were labelled with maleimide-Atto 495 (Merck Life Science UK). EcFtsA1-405 and VmFtsA1-396 were buffer exchanged into binding buffer (50 mM HEPES/KOH ...
-
bioRxiv - Cell Biology 2021Quote: ... ligation for 30 min 37 °C and polymerase reaction overnight at 37 °C according to manufacturer’s protocol (Merck, Duolink® In Situ Detection Reagents Red ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Biochemistry 2024Quote: ... and 3 μL (equivalent to 3 mg cell dry weight) were spotted on HPTLC silica gel 60 plates (Merck) and developed in chloroform/methanol/13 M NH3/1 M NH4Ac/water (180:140:9:9:23 ...
-
bioRxiv - Cell Biology 2021Quote: ... and c-Fos (PC05; Merck; 1:200). Nuclei were visualized with 4’,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Microbiology 2022Quote: ... and Compound C were procured from Merck Millipore.
-
bioRxiv - Pathology 2023Quote: ... anti-surfactant protein C (SFTPC, AB3786, Merck), homemade anti-α-smooth muscle actin (clone 1A4 ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 mg/mL cytochrome c (Merck C7752)] in complex IV buffer) ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The embryos were then incubated with anti-cleaved caspase 3 pAb (1:100) (Anti-caspase-3, cleaved (Ab-2) Rabbit pAB (PC679; Merck) followed by a wash and a second incubation with anti-rabbit 568 ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Neuroscience 2024Quote: ACS was prepared from astrocyte cultures with aNSPC medium and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243 to obtain a < 3 kDa and a > 3 kDa fraction ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3-NT (1:1000, 06-284, Merck) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... or 3-NT (1:1000; 06-284, Merck). Following primary antibody incubation ...
-
bioRxiv - Plant Biology 2024Quote: ... protoplasts were treated with 3 µM DAPI (Merck) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... 3 rounds of phenol-chloroform-isoamyl alcohol (Merck) extraction were performed using 15 ml gel-lock tubes (QIAGEN) ...
-
bioRxiv - Immunology 2024Quote: ... Clear whole-cell extracts were prepared by centrifugation at 20000g for 20min at 4°C and incubated with EZview Red Anti-c-Myc-Affinity gel (Merck) for overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... the supernatants of lysed cells were incubated in shake tubes over 16 h at 4°C with c-Myc antibodies (9E10 M5546, Merck). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C then moved to 37°C and incubated for 1 h with or without 100 µM cytochalasin D (Merck), 100 µM jasplakinolide (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...