Labshake search
Citations for Merck :
101 - 150 of 4111 citations for 7 Bromo 2H 1 3 benzodioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were first permeabilized in PBS 0.5% Triton X-100 for 2h at room temperature and incubated in 10µg/mL DAPI (Sigma-Aldrich-Merck, D9542) for 30min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 1 mM DTT and 1× cOmplete protease inhibitor (Merck)] were added and incubated on the rotating wheel for 2 h at 4ºC ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Immunology 2024Quote: ... ∼5,000 previously anti-dinitrophenyl (DNP) IgE-sensitized lung MCs (overnight at 1 µg/ml, clone SPE-7, Merck) were washed in Tyrode buffer (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Molecular Biology 2019Quote: Inflorescences were harvested into fresh fixative (3:1 96% ethanol (Merck) and glacial acetic acid ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.48 mM MgSO4 x 7 H2O (Merck, 1058860500), 1.2 mM KCl (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... anti-HA (HA-7, H3663, lot 066M4837V, Merck) 1/1,000 ...
-
bioRxiv - Neuroscience 2022Quote: D-(+)-Glucose (G8270, CAS 50-99-7, Merck) in Perfusion Fluid CNS was used to prepare nanoESI-FTMS calibration samples ...
-
bioRxiv - Microbiology 2022Quote: ... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... anti-HA (HA-7, H3663, lot 066M4837V, Merck) 1/1,000 ...
-
bioRxiv - Cell Biology 2019Quote: ... cleared extracts were incubated 2h-6h at +4°C in an orbital shaker with anti-FLAG sepharose beads (M2 clone, Merck, A2220). Bound complexes were pelleted and 5x washed (Lysis buffer with 1M NaCl) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 90% and 100% ethanol and 5 min in xylene/ethanol (1:1, Merck) and 5 min in xylene ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Bioengineering 2023Quote: ... The 1.5 ml resuspended RBCs were cultured in 50 ml HPS containing 2 mM CaCl2 and 2 µM calcium ionophore-4-bromo-A23187 (C7522, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) in T75 flasks in a 5% CO2 incubator at 37°C for 16 h ...
-
bioRxiv - Genetics 2023Quote: ... after adding 2 g activated (i.e., baked at 300°C for 2h) molecular sieves (5Å, 45-60 mesh size, Merck, KGaA, Darmstadt, Germany). The molecular sieves were filtered out by loading the extract into a glass funnel (50 mm inner diameter ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Biophysics 2020Quote: 19) Potassium chloride (KCl, Merck, CAS # 7447-40-7)
-
bioRxiv - Microbiology 2021Quote: ... Cuttings were transferred in magenta GA-7 vessels (Merck), incubated at 28°C ...
-
bioRxiv - Immunology 2022Quote: ... mouse CC1 Anti-APC (Ab-7) (#OP80-100UG, Merck) and mouse anti-Olig2 (#66513-1-IG ...
-
bioRxiv - Neuroscience 2022Quote: ... n-amyl acetate (AM; CAS: 628-63-7, Merck) diluted 1:20 in paraffin oil (CAS ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... either n-amylacetate (AM; CAS: 628-63-7, Merck, Darmstadt ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7% FBS (BioWest) and 10μg/mL Blasticidin hydrochloride (Merck)45.
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Pathology 2023Quote: Cryosections of formalin-fixed lung tissue 7 μm thick were washed in PBS and permeabilized for 1 h with 0.01% Tween 20 (Sigma-Merck, Germany), followed by three washes in PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... lysates were clarified by centrifugation at 12000g and incubated 2h at 4°C with pre-equilibrated α-FLAG M2 affinity gel beads (Merck-Sigma, A2220). Beads were washed three times with lysis buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were mounted using a 3:1 solution of Canada balsam (Merck, # 1016910100) and Histoclear (HS-202 HISTO-CLEAR II ...
-
bioRxiv - Cell Biology 2020Quote: ... or rabbit anti-p34-Arc/ARPC2 (Arp2/3, 1:100, Merck, 07-227). This was followed by incubation with appropriate Alexa Fluor-conjugated secondary antibodies (1:500 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM DTT) and concentrated using a 3 kD MWCO centricon (Merck Millipore). For best performance in the iSAT reaction ...
-
Highly amine-reactive graphene-oxide EM grids for biochemical surface modification in aqueous bufferbioRxiv - Molecular Biology 2023Quote: ... 4-Amino-1-butanol (#178330) and 3- glycidoxypropyltrimethoxysilane (#440167) were obtained from Merck. Gold nanoparticle- PEG-amine conjugate was custom-synthesized by NanoPartz (Loveland CO ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... or 1-octanol was used (1-OCT; CAS: 111-87-5; Merck, Darmstadt, Germany; undiluted). Paraffin is without behavioural significance in larval Drosophila (Saumweber et al ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...