Labshake search
Citations for Merck :
101 - 150 of 4640 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... spiked with L-leucine-5,5,5-d3 at 5 mg/L (99 atom % D; Merck KGaA), which was prepared in a methanol and water solution (50:50).
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Neuroscience 2019Quote: ... 0.92 mM phosphoric acid and 4% 2-propanol (all chemicals Merck KGaA, Darmstadt, Germany). Monoamines were detected using an electrochemical detector (41 000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (#D9542, Merck. Darmstadt. Germany).
-
bioRxiv - Physiology 2022Quote: ... cultures were fixed with 4% PFA and stained with 2% Alizarin red S (Merck). For the quantification ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µl T4 buffer and 2 µl 50% PEG4000 (Merck, Kenilworth, NJ). After incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µM epoxomicin and 50 µM (Z-LL)2-ketone (Merck Millipore) were added from stock solutions in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μg/mL insulin (Merck) and 5 μM rosiglitazone (Merck) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg/ml insulin (Merck), 1% (v/v ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg/ml hydrocortisone (Merck) and 1% penicillin streptomycin mix (Fisher scientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg/ml heparin (Sigma/Merck), 20 ng/ml EGF (Peprotech) ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 μg/mL PI (Merck, Germany) and 12 μg/mL Hoechst 33342 (Miltenyi Biotec ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Immunology 2020Quote: ... naïve T cells were freshly isolated and subsequently cultured for 4/5 days in RPMI (Merck), containing 10% Heat Inactivated FCS (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... (2) we added 50 µg/mL (0.28 collagenase Wünsch units) of Liberase TM (Merck) in the digestion solution ...
-
bioRxiv - Microbiology 2019Quote: ... PfCERLI1HAGlmS parasites were transfected with the an episomal cytosolic GFP expressing plasmid pHGBrHrBl-1/2 and maintenance of this plasmid was selected for using 5 μg/mL blasticidin-S-deaminase HCl (Merck Millipore). Maintenance of the SLI-TGD plasmid was selected for using 20 μM WR99210 ...
-
bioRxiv - Biochemistry 2020Quote: ... Total extract was clarified by 20 min centrifugation at 30,000 rcf at 4°C and the soluble fraction was loaded on affinity chromatography over 5 mL of NiNTA resin (Sigma-Aldrich Merck, Darmstad Germany). Resin was step-washed with 10 mL of buffer A supplemented with 10 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Microbiology 2023Quote: ... 2–3 mL of stock solution was applied onto preparative TLC plates (glass, Merck, 20×20 cm ...
-
bioRxiv - Biophysics 2020Quote: ... 85 ug/mL catalase (Merck) and 1 mM Trolox (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: ... 85 ug/mL catalase (Merck) and 1 mM Trolox (Sigma)) ...
-
bioRxiv - Biophysics 2019Quote: ... DNase 500 ug/ml (Merck) was added and passed twice through a French pressure cell at 1,500 psi ...
-
bioRxiv - Biophysics 2021Quote: ... 85 ug/mL catalase (Merck) and 1 mM Trolox (Sigma)).
-
bioRxiv - Biophysics 2019Quote: ... DNase 500 ug/ml (Merck) was added and passed twice through a French pressure cell at 1,500 psi and 2mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The protein was concentrated overnight to a volume of 2 mL in a Vivaspin 20 Ultrafiltration Unit (5 kDa MWCO)(Merck, Darmstadt, Germany) and then loaded onto a HiLoadTM 26/60 Superdex TM 75 prep grade (GE Healthcare ...
-
bioRxiv - Immunology 2019Quote: ... 5 μg of the following antibodies were used: H4ac (Histone 4 pan-acetyl, Merck Millipore #06-866) anti-H3K27ac (Abcam ab4729) ...
-
bioRxiv - Biochemistry 2022Quote: ... EGTA-eluates were pooled and concentrated to a final concentration of ∼2 mg/ml using an Amicon Ultra-4 cellulose centrifugal filter unit (Merck Millipore, Cat# UFC810024).
-
bioRxiv - Biochemistry 2020Quote: ... and a SeQuant ZIC-HILIC precolumn (5 μm particles, 20 × 2 mm) (Merck, Darmstadt, Germany) using a linear gradient of mobile phase A (5 mM NH4OAc in acetonitrile/H2O (5/95 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells nuclei were stained with DAPI (4′,6-diamidino-2-fenilindol, 1:10000, Merck, cat#D9542) for 5 minutes at RT and mounted in Lab Vision™ PermaFluor™ Aqueous Mounting Medium (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then incubated with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; Merck Millipore) and mounted on slides with Mowiol (Merck Millipore ...
-
bioRxiv - Cancer Biology 2024Quote: ... counterstained with 5µg of 4’,6-diamidino-2-phenylindole (DAPI – 1:1) (Sigma/Merck, D9542-10mg) to eliminate dead cells before running through the flow cytometer ...
-
bioRxiv - Molecular Biology 2022Quote: ... proteasomal degradation inhibitor: MG132 (5 – 50 µM, Merck KgaA); cathepsin inhibitors ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Neuroscience 2023Quote: ... bovine insulin (5 µg/mL, Merck) was added after 7 days in culture ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μg/ml insulin (Merck, I9278), 100 μg/mL transferrin ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 μg/ml human insulin (Merck), and 50 μM hydrocortisone (Cayman ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Genomics 2020Quote: ... 250 U/mL benzonase (Merck, 70746-4)) on ice for 1 hour prior to centrifugation at 4°C (20kg ...
-
bioRxiv - Immunology 2020Quote: ... and Polybrene (4 μg/ml; Merck Millipore) in a total volume of 7 ml (2 ml of a 15-min-preincubated transfection mix in serum-free DMEM added to 5 ml of fresh full DMEM) ...