Labshake search
Citations for Merck :
101 - 150 of 2532 citations for 3 Chloro 5 fluoro 4' morpholinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Products were separated on a LiChroCART 125-4 RP-18 end-capped 5 µm column (Merck, Darmstadt, Germany) with a solvent system of methanol and phosphoric acid (0.1% ...
-
bioRxiv - Molecular Biology 2022Quote: ... concentrated with an Amicon Ultra-4 centrifugal filter with a 5 kDa molecular weight cutoff (UFC8003, Merck Millipore), snap frozen and stored at -80 °C either directly (used for cryo-EM ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 μM of the protease inhibitor 4-(2-aminoethyl)-benzolsulfonyfluorid hydrochloride (BioChemica) and 5 U/mL-benzonase (Merck) were added (final concentrations) ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Genetics 2024Quote: ... The harvested medium was then centrifuged at 1,300 rpm at 4 °C for 5 min to remove cells and then filtered by 0.45 μm filter (Merck) and the virus was collected and stored at -80 °C.
-
bioRxiv - Cell Biology 2023Quote: ... P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore, SLHV033RS). P2 virus was either propagated further or stored at 4ºC in the dark ...
-
bioRxiv - Bioengineering 2024Quote: ... or 3-5×105 pelleted cells were lysed in TRI Reagent (“LS” for fluid EV samples, conventional for cells, Merck Millipore). Liquid chloroform was added to the lysates at a 1:5 v/v ratio and vigorously mixed for 30 s ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of Protein powder solutions (1 mg/ml) were added to 3 cm NG plates with 10 µM 5-FU (Merck, #F6627). After the plates had dried ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... rat slices were exposed to 3 μM dihydroethidium (DHE) while in humans’ sections it was added 4 μM DHE (Merck, Darmstadt, Germany) for 30 minutes at 37ºC 51 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Neuroscience 2024Quote: ... Homogenized tissue was centrifuged at 16,000 g for 45 min at 4 °C and the remaining supernatant was spun in 3 kDa cut-off Amicon® centrifugal filter tubes (Merck Millipore) at 14,000 g for 90 min at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 5×106 cells from treated and untreated conditions were centrifuged for 5 min at 4,500 g and the pellets were resuspended in 4% paraformaldehyde (PFA, Merck, Germany), and incubated for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... equipped with a LiChrospher® 100 RP-18 (125 mm x 4 mm, 5 µm) C18 reversed-phase column (Merck). The elution solvents consisted of ultrapure water with 0.1% formic acid (A ...
-
bioRxiv - Plant Biology 2024Quote: ... Blots were blocked for 1 hours at 21°C or overnight at 4°C with 5% (w/v) skim milk in PBS-T (PBS tablets; Merck 524650, 0.1% Tween-20; Merck P1379). The membrane was incubated with 1:5000 anti-flagellin antibody (Taguchi et al ...
-
bioRxiv - Physiology 2024Quote: ... The tissues were fixed in 4% paraformaldehyde and were blocked with 5% normal donkey serum (NDS) (Merck, Cat# D9663, RRID:AB_2810235), 0.2% tween-20 in phosphate buffered saline (PBS ...
-
bioRxiv - Immunology 2021Quote: ... The membrane was blocked using 1x TBST+ 3% Casein followed by overnight incubation at 4°C with biotinylated Lectin from Triticum Vulgaris (Sigma/Merck Cat. No. L5142). The membrane was washed with 1XTBST and further Incubated with Streptavidin PerCP-eFluor710 Conjugated ...
-
bioRxiv - Cell Biology 2022Quote: ... shMYO10 #3 and shMYO10 #4 cell lines were generated using lentiviruses particles containing a non-target control shRNA (Merck, Cat Number: SHC016V-1EA) or shRNA targeting human MYO10 respectively (shMYO10 #3 ...
-
bioRxiv - Biochemistry 2022Quote: ... Loss of Memo was induced by 3 daily intraperitoneal injections with 2mg tamoxifen at age 4 weeks (T5648 Sigma-Aldrich, distributed through Merck, Buchs Switzerland). Memofl/fl littermates without Cre but treated with tamoxifen served as controls ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Cell Biology 2023Quote: ... For NMR-experiments the proteins were concentrated by repeated ultrafiltration (Amicon Ultra-4 Ultracel-3 kDa centrifugal filter device, Merck Millipore, Burlington, USA).
-
bioRxiv - Microbiology 2024Quote: ... The purity was controlled by electrophoresing 3 µg of protein with SDS-sample buffer on a polyacrylamide gel (mPAGE™ 4-20% Bis-Tris Precast Gel, Merck, Darmstadt, Germany), followed by Bio-Safe Coomassie staining (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... protease cleavage site at the N-terminus site was subcloned between KpnI (5’-terminus) and HindIII (3’-terminus) restriction enzyme sites in the pRSF-1b vector (Merck, Darmstadt, Germany) to express His-TEV protease site-MA protein (pRSF-1b_MA ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 100 μL acetonitrile and rehydrated with 25 μL trypsin solution, containing 5 ng/μL trypsin (cat # 37283, SERVA Electrophoresis GmbH, Heidelberg) in 3 mmol/L ammoniumbicarbonate (cat # 09830, Merck KGaA, Darmstadt). After 4 h incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3% casein (Merck) in 20 mM TBS (pH 11.0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nutlin-3 (Merck) was dissolved in DMSO and diluted in saline.
-
bioRxiv - Molecular Biology 2021Quote: ... was centrifuged at 1500 rpm for 10 mins and the supernatant was used to measure inflammatory cytokines (IL-4, IL-5, IL-13, γ-INF) by LUMINEX multi-factor detection (MERCK). The cell pellets were fixed in 4% formaldehyde for Wright-Giemsa staining and total cells were counted and classified in each slide.
-
bioRxiv - Systems Biology 2020Quote: TGF-β/Activin/Nodal signal inhibitor (SB) stock (4–5 mM): SB 431542 hydrate (#S4317-5MG, Merck & Co., Inc., NJ, USA) diluted in DMSO (#D2650-5×5ML ...
-
bioRxiv - Cancer Biology 2024Quote: ... After 30 minutes of incubation 100 μL of 2X STOP buffer (NaCl 340 mM, EDTA 20 mM, EGTA 4 mM, 5% Digitonin, 100 μg/mL RNase A (Merck, R6513), 50 μg/mL Glycogen (Thermo Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... Elution sample was concentrated at 3,300 rpm for 5 minutes per round until it reached 500 uL with Amicon Ultra-4 30K centrifugal filter system (Merck Millipore). Size exclusion chromatography was performed with Superdex200 increase 10/300 column (Cytiva ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4-aminopyridine (4-AP) (100 μM, Merck) was bath perfused to isolate direct monosynaptic inputs during photostimulation.
-
bioRxiv - Microbiology 2022Quote: ... the supernatants were concentrated 50-fold using Amicon Ultra-4 centrifugal filters with a molecular weight cut-off of 3 kDa (Merck-Millipore, Burlington, MA, USA). Samples were mixed with 3× Laemmli loading buffer and heated for 3 min at 85 °C before SDS-PAGE analysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... The flow through and wash fractions were concentrated to 3-5 mg/mL using Amicon ultrafiltrators (10 kDa MWCO, Merck Millipore, Darmstadt, Germany). All fractions were combined and dialyzed 2x over night at 4 °C against 5 L 10 % (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... mice were gavaged with 0.2 ml of Fluorescein Isothiocyanate-Dextran (FITC-Dextran; 3–5 kDa; cat. no. FD4; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) in PBS ...