Labshake search
Citations for Merck :
101 - 150 of 3392 citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... The embryos were then incubated with anti-cleaved caspase 3 pAb (1:100) (Anti-caspase-3, cleaved (Ab-2) Rabbit pAB (PC679; Merck) followed by a wash and a second incubation with anti-rabbit 568 ...
-
bioRxiv - Neuroscience 2023Quote: ... The protein was concentrated with an Amicon Ultra-4 (Merck Millipore, MWCO 3 K) to a concentration of 726 µM ...
-
bioRxiv - Cell Biology 2021Quote: The vessel lumen was washed 3 times with PBS ++ (PBS with 1mM CaCl2, 0.5mM MgCl2) and fixed with 4% paraformaldehyde (PFA, Merck, #30525-89-4) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were stored at 4°C overnight before desilicification with 4% suprapure hydrofluoric acid (Merck; incubation of approximately 5 hours). Afterwards ...
-
bioRxiv - Biophysics 2023Quote: ... The following antibodies were used: anti-acetyl Histone H3 (Lys9) (06-942, Merck & Co., Inc.), and anti-GAPDH (2118 ...
-
bioRxiv - Cell Biology 2021Quote: ... SV40 T Antigen (Ab-2) (Merck Millipore; DP02; 5 μg/ml). Secondary antibodies (all from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Treatment with 2 µM hydrogen peroxide for 5 min (H2O2; Merck) was used to induce DNA strand-breaks and oxidative damage ...
-
bioRxiv - Genetics 2022Quote: ... 90 μl 5 M NaCl and 2 μl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... and anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Neuroscience 2022Quote: ... with a Chromolith® RP-18 endcapped 5-3 guard cartridges (Merck, Darmstadt, Germany), operated under a flow rate of 0.3 mL/min ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by 3 PBS washes and blocking with 5% bovine serum albumin (BSA; Merck) for 1 hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... The beads were pre-bound with 4-5 micrograms of antibodies (H3K4me3 – Merck 07-473 ...
-
bioRxiv - Immunology 2021Quote: ... and washed by ultracentrifugation at 4°C using a 3 kDa filter (UFC900324, Merck-Millipore) to remove imidazole ...
-
bioRxiv - Neuroscience 2023Quote: For conditioning the odors 4-MCH (1:250, Merck, Darmstadt, Germany,CAS #589-91-3) and 3-OCT (1:167 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and left overnight at 4°C in blocking solution containing 3% Donkey Serum (D9663, Merck) and 0.03% Sodium Azide (40-2000-01 ...
-
bioRxiv - Biophysics 2024Quote: ... 1,2-Distearoyl-sn-glycero-3-phosphocholine (DSPC, CAS: 816-94-4) was sourced from Merck KGaA (Darmstadt ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3T3-J2 fibroblasts were treated for 3 hours with 4 μg/mL mitomycin C (Merck) at 37°C ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 2 % (vol/ vol) FCS and and 10 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, Merck) and cut into 1 cm pieces ...
-
bioRxiv - Cell Biology 2020Quote: ... pre-cleared extracts (2 mg) were incubated for 4 hr at 4 °C with 2 μg of pan–ADP–ribose binding reagent (MABE1016, Merck) or normal rabbit IgG (2729S ...
-
bioRxiv - Neuroscience 2022Quote: ... Following counterstaining with 4’,6-diamidino-2-phenylindole (DAPI; Vectashield/Biozol) slices were mounted in Mowiol 4-88 (Merck Chemicals).
-
bioRxiv - Biochemistry 2020Quote: We obtained mevastatin (M2537), mevalonate (50838) and N-acetyl-leucinyl-leucinyl-norleucinal (ALLN, 208719) from Merck, Germany ...
-
bioRxiv - Microbiology 2020Quote: ... In experiments including the reversible cysteine protease inhibitor N-acetyl-Leu-Leu-Norleu-al (ALLN) (Merck), parasite lysates were pre-incubated with 10 µM of the inhibitor for 30 min prior to addition of the ABP for a further 15 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies used were CYFIP1/2 (Sra-1/PIR121 [14], Rac1/3 (23A8, Merck), Nap1 [14] ...
-
bioRxiv - Neuroscience 2023Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay was used to analyze the cell viability of SH-SY5Y cells ...
-
bioRxiv - Cancer Biology 2024Quote: The 3-(4,5-dimethylthiazo1-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Merck Sigma, Burlington, MA) reduction assay was used to quantify cell proliferation ...
-
bioRxiv - Microbiology 2024Quote: ... 2–3 mL of stock solution was applied to preparative TLC plates (glass, Merck, 20x20 cm ...
-
bioRxiv - Cell Biology 2024Quote: ... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Neuroscience 2024Quote: ... xylene (2 x 5 min) and coverslipped using Entallan mounting medium (Merck). Samples were imaged using an Olympus BX51 microscope equipped with an Olympus DP27 digital camera (Olympus Microscope Solutions).
-
bioRxiv - Cancer Biology 2024Quote: ... 2 nM T3 supplement (3,3′,5-triiodo-l-thyronine sodium salt) (Merck), and 100 IU/mL penicillin and 100 µg/mL streptomycin (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Neuroscience 2022Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Microbiology 2024Quote: ... polyethylene glycol was added to a final concentration of 5% (Cat # 25322-68-3, Merck), and a LFA strip (Cat # 3822-9000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Grids were then stained with 2% (w/v) uranyl acetate pH 4 (Merck) for 1 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... The nuclei were stained with 4′,6-diamidin-2-phenylindol (DAPI, Merck, Germany).
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Neuroscience 2024Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (D9542) (all from Merck, Auckland, NZ). See table S2 for antibodies used for immunocytochemistry (ICC).
-
bioRxiv - Microbiology 2024Quote: ... was obtained by using 4’,6-di-amidino-2-phenyl-indole (DAPI; Merck KGaA - Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Molecular Biology 2022Quote: ... Acetylation was evaluated with Western blot probed with anti-acetyl lysine antibodies (1:800 dilution) (Sigma/Merck). Mass spectrometry outsourced to Mass Spectrometry Laboratory IBB PAN ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...