Labshake search
Citations for Merck :
101 - 150 of 4579 citations for 1 Benzyl 3 Tert Butyldimethylsilyl Oxy Methyl Piperidin 4 One since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µM Carbonyl cyanide 3-chlorophenylhydrazone (CCCP; Merck, Cat. #C2759, Germany), 1 µM rotenone (Merck ...
-
bioRxiv - Molecular Biology 2024Quote: ... The embryos were then incubated with anti-cleaved caspase 3 pAb (1:100) (Anti-caspase-3, cleaved (Ab-2) Rabbit pAB (PC679; Merck) followed by a wash and a second incubation with anti-rabbit 568 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 % Triton-X and 1x BugBuster (Merck Millipore, #70584-4) were added to lyse the bacteria for 30 min at 4 °C with gentle rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM TCEP with 4% SYPRO Orange dye (Merck, #S5692) were filtered in SpinX tubes (Corning ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Merck) was added for nuclear staining and incubated at room temperature for 10 min ...
-
bioRxiv - Systems Biology 2024Quote: ... one part ice-cold TCA (Merck 1008071000) was added to four parts of the protein sample ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was supplemented with calcium chloride to a final concentration of 3 mM and chromatin was solubilised for 2 h at 4 °C by digestion with Turbonuclease (T4330, Merck) to a final concentration of 250U/ml ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dried pellet was mixed with Lysis buffer (9M urea, 4 wt% CHAPS, 2% Pharmalyte carrier ampholyte pH 3-10, Merck) and left overnight at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-phosphorylated (Ser897)-N-methyl-D-aspartate receptor (anti phosphoNMDAR cat.#ABN99, Merck Millipore, Burlington, MA, USA), anti-total-calcium/calmodulin-dependent protein kinase II (anti-tCaMK ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mixture (2:1 v/v) of (PFA 4% (Merck, 104005) in PBS 1X pH7.4):OCT (Leica Surgipath ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti-pan- histone H11-4 (1:500; Merck, Cat#MAB3422) or chicken anti-GFP (1:500 ...
-
bioRxiv - Pathology 2023Quote: ... 1:1000 4-repeat tau (aa 275-291, 05-804, Merck); 1:500 3-repeat tau (aa 267-316 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Merck), mounted (Aqua Poly/Mount ...
-
bioRxiv - Cancer Biology 2024Quote: ... DSB were induced with 4-nitroquinoline 1-oxide (4NQO) (Sigma/Merck).
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...
-
bioRxiv - Neuroscience 2020Quote: ... and one 11μM nylon filter (NY1102500, Merck Millipore). The filtrate was centrifuged at 1500 rcf for 15 minutes at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... One mL of virus stock and 9 mL of MEM-E supplemented with 1% pyruvate (Merck KGaA, Darmstadt, Germany) were added to a conical tube with 16 × 106 SK-6 cells and shaken for 30 minutes at 104 rpm and 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were mounted using a 3:1 solution of Canada balsam (Merck, # 1016910100) and Histoclear (HS-202 HISTO-CLEAR II ...
-
bioRxiv - Cell Biology 2020Quote: ... or rabbit anti-p34-Arc/ARPC2 (Arp2/3, 1:100, Merck, 07-227). This was followed by incubation with appropriate Alexa Fluor-conjugated secondary antibodies (1:500 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM DTT) and concentrated using a 3 kD MWCO centricon (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 0.1% Tween-20 (PBS-T) and blocked using PBS supplemented with 4% w/v skimmed milk powder (PBSM-4%; Merck Millipore) for 1h at room temperature (RT) ...
-
bioRxiv - Immunology 2020Quote: ... rAAVDJ or rAAV6 genome plasmid and Donor plasmid at a 3:1:1 ratio in Polyethylenimine (PEI)(Merck). In total each plate was teransfected with 41,250ng of DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... rat slices were exposed to 3 μM dihydroethidium (DHE) while in humans’ sections it was added 4 μM DHE (Merck, Darmstadt, Germany) for 30 minutes at 37ºC 51 ...
-
bioRxiv - Cell Biology 2023Quote: ... The blots were developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-brom-4-chlor-3-indoxylphosphate (BCIP; Merck, Darmstadt, Germany) for 5–30 min at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... Homogenized tissue was centrifuged at 16,000 g for 45 min at 4 °C and the remaining supernatant was spun in 3 kDa cut-off Amicon® centrifugal filter tubes (Merck Millipore) at 14,000 g for 90 min at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM EGTA) and fixated for 20 min with 4% paraformaldehyde (Merck). Then ...
-
bioRxiv - Biochemistry 2023Quote: ... 400 μg of AtLEGβ or papain were inhibited with 0.5 mM or 5 mM S-methyl methanethiosulfonate (MMTS, Merck), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... and then embedded in BMM resin (butyl methacrylate, methyl methacrylate, 0.5% benzoyl ethyl ether with 10 mM DTT (Merck)) at -20°C under UV light for polymerization ...