Labshake search
Citations for Merck :
101 - 150 of 5384 citations for 1 2 Bromoethoxy 3 5 dimethylbenzene 97+% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by a 3 h blocking step with 5 % NGS (G9023, Merck, Darmstadt Germany) in the respective washing buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 6809-1102) PBS (3 × 50 μL) before incubation with gold nanoparticles (5 μL, 0.1 μm, Merck) for 20 minutes.
-
bioRxiv - Microbiology 2024Quote: ... or miR-21 scramble control (Sequence: 5’ - GCAUAUUCGGUCGUUAUAAGAU - 3’; custom designed MISSION® microRNA Mimic, Merck) were diluted in water ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). For Ki67 and IBA1 staining ...
-
bioRxiv - Immunology 2022Quote: ... and 2 µl of pH 5 citrate-phosphate buffer excipient (Merck, Darmstadt, Germany); and endpoint B ...
-
bioRxiv - Bioengineering 2022Quote: ... Compounds were separated on a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Genetics 2023Quote: Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
bioRxiv - Immunology 2024Quote: ... 5 and 2 minutes respectively (Elastin van Gieson staining kit, Merck, Melbourne, Australia). Antigen retrieval methods have been previously described 128 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 x 5 mins in PBS with 0.2% Triton X-100 (Merck, T8787) and 0.2% BSA (PBT ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2023Quote: ... after adding 1 mL of chloroform:methanol 2:1 (v:v) (Merck), the sample was vortexed at 1200 rpm for 1 h at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was isolated using 1-bromo-3-chloropropane (Merck) and the Analytik Jena Kit (#845-KS-2040050) ...
-
bioRxiv - Bioengineering 2021Quote: ... media supplemented with 100 µg/mL FITC-dextran with sizes of 3-5 kDa (FD4; Merck KGaA) or 40 kDa (FD40 ...
-
bioRxiv - Cell Biology 2022Quote: Depletion of Cav1 was achieved by RNAi using siRNAs with the following sequence: 5’ GCAUCAACUUGCAGAAAGA 3’ (Merck), and Control siRNA Luciferase ...
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Plant Biology 2021Quote: ... The two immune priming activator compounds SA and BABA (purity 99 and 97%) were purchased from Merck (MilliporeSigma, US).
-
bioRxiv - Developmental Biology 2022Quote: ... embryos were initially incubated with 100 µM EdU (5-ethynyl-2’-deoxyuridine) (Merck, T511285) for 1 h before washing and fixation ...
-
bioRxiv - Immunology 2023Quote: ... or 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck).
-
bioRxiv - Cancer Biology 2023Quote: ... 5 mM MgCl2 1 mM DTT and 1× cOmplete protease inhibitor (Merck)] were added and incubated on the rotating wheel for 2 h at 4ºC ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Physiology 2023Quote: ... Samples were separated on a SeQuant ZIC-pHILIC column (100 3 2.1 mm, 5 mm, polymer, Merck-Millipore) including a ZIC-pHILIC guard column (2.1 mm x 20 mm ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... excess media was removed from wells and mf were incubated with 0.5 mg/ml MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Merck) in PBS at 37°C for 90 min ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Plant Biology 2024Quote: ... patens grown on PpNH4 were homogenized in 2 mL tubes using 3-mm zirconium glass beads (Merck) in presence of 500 µL of cold TEN buffer (Tris-HCl 100 mM ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to adding the cells.
-
bioRxiv - Biophysics 2022Quote: ... dimethyl sulfoxide (DMSO, Molecular Biology grade), chlorpromazine hydrochloride (CPZ, ≥ 98% TLC) and fluvoxamine maleate (FLUV, ≥ 97% HPLC) were purchased from Merck.
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 µM Carbonyl cyanide 3-chlorophenylhydrazone (CCCP; Merck, Cat. #C2759, Germany), 1 µM rotenone (Merck ...
-
bioRxiv - Biochemistry 2020Quote: ... and a SeQuant ZIC-HILIC precolumn (5 μm particles, 20 × 2 mm) (Merck, Darmstadt, Germany) using a linear gradient of mobile phase A (5 mM NH4OAc in acetonitrile/H2O (5/95 ...
-
bioRxiv - Cell Biology 2021Quote: 6 μL of 70 kDa FITC-dextran in EGM-2 (5 mg/mL, Merck, #46945) was added to each vessel ...
-
bioRxiv - Immunology 2022Quote: ... Peritoneal cavity cells were obtained by lavage with 5 mL PBS + 2 mM EDTA (Merck). Following gentle massage ...
-
bioRxiv - Biochemistry 2024Quote: ... After 2 days incubating with 5 μM ROCK Inhibitor (Y-27632, RI, from Merck Millipore), 40 μM TGF-β inhibitor (SB 431524 ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM sodium ascorbate) on ice and filtered through 2 layers of Miracloth (Merck Millipore). Intact chloroplasts were collected from a band at the interface between the 40 % (v/v ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% penicillin-streptomycin and 0.00035% 2-mercaptoethanol (Merck)) to an orbital shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of 1 M DTT (Merck, D9779) was added and the sample was heated for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... the MEK1/2 inhibitor PD0325901 (1 μM, Merck), LDN-193189 (100 nM ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of chloroform:isopropanol 2:1 (v:v)(Merck) were used to elute the neutral lipid fraction (NL) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 90% and 100% ethanol and 5 min in xylene/ethanol (1:1, Merck) and 5 min in xylene ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...